View allAll Photos Tagged polymorphic
Visiting one of my mothing lights set up at cabin 3 at Brendan T. Byrne State Forest, here in the Jersey pinelands.
Butterflies are insects in the macrolepidopteran clade Rhopalocera from the order Lepidoptera, which also includes moths. Adult butterflies have large, often brightly coloured wings, and conspicuous, fluttering flight. The group comprises the large superfamily Papilionoidea, which contains at least one former group, the skippers (formerly the superfamily "Hesperioidea") and the most recent analyses suggest it also contains the moth-butterflies (formerly the superfamily "Hedyloidea"). Butterfly fossils date to the Paleocene, which was about 56 million years ago.
Butterflies have the typical four-stage insect life cycle. Winged adults lay eggs on the food plant on which their larvae, known as caterpillars, will feed. The caterpillars grow, sometimes very rapidly, and when fully developed, pupate in a chrysalis. When metamorphosis is complete, the pupal skin splits, the adult insect climbs out, and after its wings have expanded and dried, it flies off. Some butterflies, especially in the tropics, have several generations in a year, while others have a single generation, and a few in cold locations may take several years to pass through their entire life cycle.
Butterflies are often polymorphic, and many species make use of camouflage, mimicry and aposematism to evade their predators. Some, like the monarch and the painted lady, migrate over long distances. Many butterflies are attacked by parasites or parasitoids, including wasps, protozoans, flies, and other invertebrates, or are preyed upon by other organisms. Some species are pests because in their larval stages they can damage domestic crops or trees; other species are agents of pollination of some plants. Larvae of a few butterflies (e.g., harvesters) eat harmful insects, and a few are predators of ants, while others live as mutualists in association with ants. Culturally, butterflies are a popular motif in the visual and literary arts
From the first fitting @ Faliro in Greece, 2011
Design + construction: Werner Maritsas
Materials: plywood + metal
Dimensions 2.50X2.50X2.55
learn pore here: wernermaritsas.wordpress.com/
Pictured at Matiu/Somes Island, Wellington, New Zealand. The variable oystercatcher is a species of wader in the Haematopodidae family. It is endemic to New Zealand. The Maori name is torea-pango. They are also known as 'red bills'.
"Variable" refers to the frontal plumage, which ranges from pied through mottled to all black. They are polymorphic meaning they have different genetic variants. Blacker birds are more common in the south. All Stewart Island variable oystercatchers are black. The have pink legs, an orange eye ring and red beaks. They are often seen in pairs on the coast all around New Zealand. During breeding, the pair will defend their territory, sometimes aggressively. Once mated pairs rarely divorce. After breeding they may be seen within flocks, or on the edges of flocks, of black and white South Island Pied Oystercatcher (SIPO) which also have vivid orange beaks. After breeding they may even form small flocks of their own. Males are around 678 grams and females slightly larger at around 724 grams. Variables can be identified as they are slightly larger than the SIPO - SIPO are around 550 grams. Occasionally totally black but if they are pied (black and white) they can be easily confused with SIPO. The variable species has less definition between the black and the white area, as well as a mottled band on the leading edges of the underwing. Variables also have a smaller white rump patch which is only a band across the base of the tail rather than a wide wedge shape reaching up to the middle of the back as in the SIPO. When mottled they are sometimes called 'smudgies'. They feed on molluscs, crabs and marine worms. After heavy rain, they sometime go inland in search of earthworms. They can open a shellfish by either hammering a hole in it or getting the bill between the two shells (of a bivalve) and twisting them apart. They breed in North Island, South Island, Stewart Island, and Chatham Islands. They do not breed inland or beside rivers although the SIPO does. They nest on the shore between rocks or on sand dunes by making a scrape out of the sand or shingle, sometimes lined with some seaweed. When in flight they make a high pitched 'kleep kleep' sound. They usually lay 2-3 eggs but they can lay up to 5. The eggs are typically stone coloured with small brown patches all over. Eggs hatch in 25-32 days. Chicks are well camouflaged by their colour and can fly in about 6 weeks. The bird lives up to about 27 years.
Pictured at Matiu/Somes Island, Wellington, New Zealand. The variable oystercatcher is a species of wader in the Haematopodidae family. It is endemic to New Zealand. The Maori name is torea-pango. They are also known as 'red bills'.
"Variable" refers to the frontal plumage, which ranges from pied through mottled to all black. They are polymorphic meaning they have different genetic variants. Blacker birds are more common in the south. All Stewart Island variable oystercatchers are black. The have pink legs, an orange eye ring and red beaks. They are often seen in pairs on the coast all around New Zealand. During breeding, the pair will defend their territory, sometimes aggressively. Once mated pairs rarely divorce. After breeding they may be seen within flocks, or on the edges of flocks, of black and white South Island Pied Oystercatcher (SIPO) which also have vivid orange beaks. After breeding they may even form small flocks of their own. Males are around 678 grams and females slightly larger at around 724 grams. Variables can be identified as they are slightly larger than the SIPO - SIPO are around 550 grams. Occasionally totally black but if they are pied (black and white) they can be easily confused with SIPO. The variable species has less definition between the black and the white area, as well as a mottled band on the leading edges of the underwing. Variables also have a smaller white rump patch which is only a band across the base of the tail rather than a wide wedge shape reaching up to the middle of the back as in the SIPO. When mottled they are sometimes called 'smudgies'. They feed on molluscs, crabs and marine worms. After heavy rain, they sometime go inland in search of earthworms. They can open a shellfish by either hammering a hole in it or getting the bill between the two shells (of a bivalve) and twisting them apart. They breed in North Island, South Island, Stewart Island, and Chatham Islands. They do not breed inland or beside rivers although the SIPO does. They nest on the shore between rocks or on sand dunes by making a scrape out of the sand or shingle, sometimes lined with some seaweed. When in flight they make a high pitched 'kleep kleep' sound. They usually lay 2-3 eggs but they can lay up to 5. The eggs are typically stone coloured with small brown patches all over. Eggs hatch in 25-32 days. Chicks are well camouflaged by their colour and can fly in about 6 weeks. The bird lives up to about 27 years.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Consensus Bayesian phylogeny of the Daphnia pulex species complexbased on the mitochondrial ND5 and COX1 genes. The alignment contains 98 sequences consisting of 496 nt of ND5 and 552 nt of COX1 with 295 polymorphic positions of which 258 are phylogenetically informative. The tree is rooted through the midpoint. Posterior probabilities are indicated on the nodes of the tree and are not shown if less than 0.80. Isolates CT-17 and CT-18 were collected from Connecticut, USA.
= Oligoporus sipticus Bondartsev & Singer (1941)
= Postia stipticus Jülich (1982)
Projet d'inventaire Ville de Montréal (2024)
No de spécimen : CG2796
Date : 27 sept. 2024
Station : Parc Angrignon
Écologie : Sur bois décortiqué de feuillu
Récolté par : Chantal Gauthier
Déterminé par : Chantal Gauthier
Collectionné par : Chantal Gauthier
Description :
Surface du chapeau raboteux, blanchâtre à ochracé.
Pores 4-6 par mm.
Contexte blanc non marbré.
Saveur très amère devenant âcre.
Note : Odeur forte, désagréable au sec.
www.inaturalist.org/observations/251470410
Seq. identique à 99,7% Amaropostia stiptica des séquences en provenance du Michigan, Indiana et NY.
À 99,25% de seq. en provenance d'anticosti MN992494 et à 99% de KC585380 d'Alaska = tout de même dans le "range" intra-spécifique régionale -> haplotype clade A. stiptica "boréal-tempéré"
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTTTTGAGGAAGTTGTTTGCTGGCCTTTTAAAAGGGGCATGTGCACGCTTCGTTCAAATTTCCAACTCTTTATACACCTGTGCACTTTTTGTAGGGTTGTGGCTGTAAAAGGCTGCACTCTATGTTTATTATATAAACTCTTTAGTATGTGTAGAATGTTCATTGCGTATAACGCATCTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCTGAGGAGCATGCCTGTTTGAGTGTCATGGAATCATCAACTCTCTTGGTCTTTATTGACTTTTAGAGAGCTTGGACTTGGAGGGTTTTTGCTGGTTTCTGTTCTTTTTTGAAGTATAAGATCAGCTCCTCTTGAATGCATTAGCTTGAACCTATGCTGTGATCGGCTGTTTGGTGTGATAATTGTCTACGCCACAGTTGTGAAAGCTATAAATATATAGGGTCAGCTTCGAACCGTCCTTTACAAATGGGACAACATCTTTATTGACCTCTGACCTCAAATCAGGTAGGATTACCCGCTGAACTT
mycomap.com/genetics/blast-search/h12-cm24-21016-inat2514...
Note inat : "100% match with Stephen Russell's MK560141 after adjusting for 2 polymorphic sites. However, RIC is only 3, therefore no reliable conclusion can be inferred from ITS sequencing at this time."
RÉFÉRENCES :
Shen, L.L., Wang, M., Zhou, J.L., Xing, J.H., Cui, B.K. & Dai, Y.C. (2019). Taxonomy and phylogeny of Postia: Multi-gene phylogeny and taxonomy of the brown-rot fungi Postia s.l. (Polyporales, Basidiomycota) and related genera. Mycosphere 10(1): 977–1000.
Miettinen, O., Rajchenberg, M., Ortiz, R. & Justo, A. (2018). The Postia caesia complex (Polyporales, Basidiomycota) in temperate Northern Hemisphere. MycoKeys 41: 95–133.
Pictured at Matiu/Somes Island, Wellington, New Zealand. The variable oystercatcher is a species of wader in the Haematopodidae family. It is endemic to New Zealand. The Maori name is torea-pango. They are also known as 'red bills'.
"Variable" refers to the frontal plumage, which ranges from pied through mottled to all black. They are polymorphic meaning they have different genetic variants. Blacker birds are more common in the south. All Stewart Island variable oystercatchers are black. The have pink legs, an orange eye ring and red beaks. They are often seen in pairs on the coast all around New Zealand. During breeding, the pair will defend their territory, sometimes aggressively. Once mated pairs rarely divorce. After breeding they may be seen within flocks, or on the edges of flocks, of black and white South Island Pied Oystercatcher (SIPO) which also have vivid orange beaks. After breeding they may even form small flocks of their own. Males are around 678 grams and females slightly larger at around 724 grams. Variables can be identified as they are slightly larger than the SIPO - SIPO are around 550 grams. Occasionally totally black but if they are pied (black and white) they can be easily confused with SIPO. The variable species has less definition between the black and the white area, as well as a mottled band on the leading edges of the underwing. Variables also have a smaller white rump patch which is only a band across the base of the tail rather than a wide wedge shape reaching up to the middle of the back as in the SIPO. When mottled they are sometimes called 'smudgies'. They feed on molluscs, crabs and marine worms. After heavy rain, they sometime go inland in search of earthworms. They can open a shellfish by either hammering a hole in it or getting the bill between the two shells (of a bivalve) and twisting them apart. They breed in North Island, South Island, Stewart Island, and Chatham Islands. They do not breed inland or beside rivers although the SIPO does. They nest on the shore between rocks or on sand dunes by making a scrape out of the sand or shingle, sometimes lined with some seaweed. When in flight they make a high pitched 'kleep kleep' sound. They usually lay 2-3 eggs but they can lay up to 5. The eggs are typically stone coloured with small brown patches all over. Eggs hatch in 25-32 days. Chicks are well camouflaged by their colour and can fly in about 6 weeks. The bird lives up to about 27 years.
Pictured at Matiu/Somes Island, Wellington, New Zealand. The variable oystercatcher is a species of wader in the Haematopodidae family. It is endemic to New Zealand. The Maori name is torea-pango. They are also known as 'red bills'.
"Variable" refers to the frontal plumage, which ranges from pied through mottled to all black. They are polymorphic meaning they have different genetic variants. Blacker birds are more common in the south. All Stewart Island variable oystercatchers are black. The have pink legs, an orange eye ring and red beaks. They are often seen in pairs on the coast all around New Zealand. During breeding, the pair will defend their territory, sometimes aggressively. Once mated pairs rarely divorce. After breeding they may be seen within flocks, or on the edges of flocks, of black and white South Island Pied Oystercatcher (SIPO) which also have vivid orange beaks. After breeding they may even form small flocks of their own. Males are around 678 grams and females slightly larger at around 724 grams. Variables can be identified as they are slightly larger than the SIPO - SIPO are around 550 grams. Occasionally totally black but if they are pied (black and white) they can be easily confused with SIPO. The variable species has less definition between the black and the white area, as well as a mottled band on the leading edges of the underwing. Variables also have a smaller white rump patch which is only a band across the base of the tail rather than a wide wedge shape reaching up to the middle of the back as in the SIPO. When mottled they are sometimes called 'smudgies'. They feed on molluscs, crabs and marine worms. After heavy rain, they sometime go inland in search of earthworms. They can open a shellfish by either hammering a hole in it or getting the bill between the two shells (of a bivalve) and twisting them apart. They breed in North Island, South Island, Stewart Island, and Chatham Islands. They do not breed inland or beside rivers although the SIPO does. They nest on the shore between rocks or on sand dunes by making a scrape out of the sand or shingle, sometimes lined with some seaweed. When in flight they make a high pitched 'kleep kleep' sound. They usually lay 2-3 eggs but they can lay up to 5. The eggs are typically stone coloured with small brown patches all over. Eggs hatch in 25-32 days. Chicks are well camouflaged by their colour and can fly in about 6 weeks. The bird lives up to about 27 years.
Photograph of our kinetic seating installation, "Polymorphic."
More at www.evolo.us/architecture/polymorphic-installation-a-kine...
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
The Polymorphic Plastic Parade (Tipi tour 09), www.plasticparade.org/ came to Austin. The members of the project had a discussion about the project at the MASS Gallery.
This was very interesting. It was a great idean and I enjoyed discovering how the idea came about and how they accomplished it.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Ants in the genus Camponotus are collectively known as carpenter ants because some species nest in wood, including man-made structure. This genus includes some of the largest and most common ants in the world, and they are found in all biogeographical regions. More than 900 species of Camponotus are known worldwide, with 50 species reported from the United States, and 20 species found east of the Mississippi River.
Species in this genus are variable in size with workers ranging in size from 3 to 15 mm or more in length and queens (also referred to as females) of some species attaining a length of 19 mm or more. Many species are polymorphic.
This species typically has relatively small colonies with less than 100 workers and at most a few hundred workers. They often nests in galleries created by other insects (including carpenter ants in the subgenus Colobopsis) in twigs and branches of trees, in insect galls, in cavities in the stalks of plants, in large seed pods, under bark of trees, in logs and stumps, wooden posts, and in houses. Small and nocturnal, this species often goes unnoticed.
mississippientomologicalmuseum.org.msstate.edu/Researchta...
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Photographed on Matiu Somes Island Wellington New Zealand.
A species of wader in the Haematopodidae family. It is endemic to New Zealand. The Maori name is torea-pango. They are also known as 'red bills'. "Variable" refers to the frontal plumage, which ranges from pied through mottled to all black. They are polymorphic meaning they have different genetic variants. Blacker birds are more common in the south. All Stewart Island variable oystercatchers are black. They have pink legs, an orange eye ring and red beaks. They are often seen in pairs on the coast all around New Zealand. During breeding, the pair will defend their territory, sometimes aggressively. Once mated pairs rarely divorce. After breeding they may be seen within flocks, or on the edges of flocks, of black and white South Island Pied Oystercatcher (SIPO) which also have vivid orange beaks. After breeding they may even form small flocks of their own. Males are around 678 grams and females slightly larger at around 724 grams.
I was a biology geek in school and we a good few trips counting snails , drawing diagrams ...they probably get to play with digi cameras now Sigh...... but if you care a brief and overly simply bio lesson ......all these snail in pictures are the same species Cepaea nemoralis it gets studied a lot in biology cos its polymorphic (within the species it has many physical forms ). On grassland you tend to find just the pale ones, cos the darker snails are very visible to feeding birds and therefore fail to pass on their genes to the next generation . But you get wildly differing types in structually diverse environments like this wood the banding good camouflage for the "stripeys" hanging out on the knots while the "pale snails" prefer the leaves .
Sinónimo de Viburnum betulifolium, pero diferente. Esta es una de las especies más polimórficas, quizás incluyendo muchas razas geográficas. Existe un patrón de variación muy complicado entre las diferentes razas geográficas en la ausencia o presencia y densidad de la pubescencia en la yema de invierno, el tubo del cáliz y la corola, y en el tamaño de la corola y el fruto, en la textura y forma de la hoja, en presencia o ausencia de pubescencia en la superficie de la hoja adaxial, y en presencia o ausencia de puntos glandulares y de pubescencia estrellada en la superficie de la hoja abaxial. Por tanto, es muy difÃcil identificar las diferentes razas geográficas. En iturraran se encuentra en la zona 3.
Synonym of Viburnum betulifolium, but different. This is a most polymorphic species, perhaps including many geographic races. There exists a very complicated variation pattern among the different geographic races in the absence or presence and density of the pubescence on the winter bud, calyx tube, and corolla, and in the size of the corolla and fruit, in the texture and shape of the leaf, in the presence or absence of pubescence on the adaxial leaf surface, and in the presence or absence of glandular dots and of stellate pubescence on the abaxial leaf surface. Thus, it is very difficult to identify the different geographic races. In iturraran is found in area 3.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
A polymorphic choker. It can be worn with the filigree heart or the ornate cross or without the pendants
Available at my Etsy shop
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Detail from the fitting @ the American College in Greece, 2011
Design + construction: Werner Maritsas
Materials: plywood + metal
Dimensions 2.50X2.50X2.55
learn pore here: wernermaritsas.wordpress.com/
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Inside view @ Faliro in Greece, 2011
Design + construction: Werner Maritsas
Materials: plywood + metal
Dimensions 2.50X2.50X2.55
learn pore here: wernermaritsas.wordpress.com/
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Hx: 17 m/o male, h/o polymorphic ventricular tachycardia of unknown etiology with ICD episode of cyanosis, meds: sotalol, Mg, Keppra (h/o seizures)
Horse Meadow Campground, Tulare County. Polymorphic population, this year there was a higher frequency of the yellow form.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Butterflies have a four-stage life cycle, as like most insects they undergo complete metamorphosis. Winged adults lay eggs on the food plant on which their larvae, known as caterpillars, will feed. The caterpillars grow, sometimes very rapidly, and when fully developed, pupate in a chrysalis. When metamorphosis is complete, the pupal skin splits, the adult insect climbs out, and after its wings have expanded and dried, it flies off. Some butterflies, especially in the tropics, have several generations in a year, while others have a single generation, and a few in cold locations may take several years to pass through their entire life cycle.
Butterflies are often polymorphic, and many species make use of camouflage, mimicry, and aposematism to evade their predators.[1] Some, like the monarch and the painted lady, migrate over long distances. Many butterflies are attacked by parasites or parasitoids, including wasps, protozoans, flies, and other invertebrates, or are preyed upon by other organisms. Some species are pests because in their larval stages they can damage domestic crops or trees; other species are agents of pollination of some plants. Larvae of a few butterflies (e.g., harvesters) eat harmful insects, and a few are predators of ants, while others live as mutualists in association with ants. Culturally, butterflies are a popular motif in the visual and literary arts. The Smithsonian Institution says "butterflies are certainly one of the most appealing creatures in nature".[2]
Paper mulberry
Cat 2 Invasive""Varies: hydric - mesic
Smooth, light brown, gaining vertical shallow furrows with maturity.Deciduous"Complexity: Simple
Arrangement: Varies: alternate, opposite, and whorled.
Shape: Polymorphic.
Margins: Serrate
Venation: sub-palmate""Thick pubescence on leaves, petitoles, and new stem growth. (Morus rubra will only have pubescence on leaves.)
Sap is milky colored
Leaves large."Aggressive colonizer.