View allAll Photos Tagged polymorphic
Ants in the genus Camponotus are collectively known as carpenter ants because some species nest in wood, including man-made structure. This genus includes some of the largest and most common ants in the world, and they are found in all biogeographical regions. More than 900 species of Camponotus are known worldwide, with 50 species reported from the United States, and 20 species found east of the Mississippi River.
Species in this genus are variable in size with workers ranging in size from 3 to 15 mm or more in length and queens (also referred to as females) of some species attaining a length of 19 mm or more. Many species are polymorphic.
This species typically has relatively small colonies with less than 100 workers and at most a few hundred workers. They often nests in galleries created by other insects (including carpenter ants in the subgenus Colobopsis) in twigs and branches of trees, in insect galls, in cavities in the stalks of plants, in large seed pods, under bark of trees, in logs and stumps, wooden posts, and in houses. Small and nocturnal, this species often goes unnoticed.
mississippientomologicalmuseum.org.msstate.edu/Researchta...
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Like its name implies, the Polymorphic Pondweed Moth, Parapoynx maculalis, can vary in color and pattern.
A polymorphic choker. It can be worn with the filigree heart or the ornate cross or without the pendants
Available at my Etsy shop
Sinónimo de Viburnum betulifolium, pero diferente. Esta es una de las especies más polimórficas, quizás incluyendo muchas razas geográficas. Existe un patrón de variación muy complicado entre las diferentes razas geográficas en la ausencia o presencia y densidad de la pubescencia en la yema de invierno, el tubo del cáliz y la corola, y en el tamaño de la corola y el fruto, en la textura y forma de la hoja, en presencia o ausencia de pubescencia en la superficie de la hoja adaxial, y en presencia o ausencia de puntos glandulares y de pubescencia estrellada en la superficie de la hoja abaxial. Por tanto, es muy difÃcil identificar las diferentes razas geográficas. En iturraran se encuentra en la zona 3.
Synonym of Viburnum betulifolium, but different. This is a most polymorphic species, perhaps including many geographic races. There exists a very complicated variation pattern among the different geographic races in the absence or presence and density of the pubescence on the winter bud, calyx tube, and corolla, and in the size of the corolla and fruit, in the texture and shape of the leaf, in the presence or absence of pubescence on the adaxial leaf surface, and in the presence or absence of glandular dots and of stellate pubescence on the abaxial leaf surface. Thus, it is very difficult to identify the different geographic races. In iturraran is found in area 3.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Detail from the fitting @ the American College in Greece, 2011
Design + construction: Werner Maritsas
Materials: plywood + metal
Dimensions 2.50X2.50X2.55
learn pore here: wernermaritsas.wordpress.com/
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
The Polymorphic Plastic Parade (Tipi tour 09), www.plasticparade.org/ came to Austin. The members of the project had a discussion about the project at the MASS Gallery.
This was very interesting. It was a great idean and I enjoyed discovering how the idea came about and how they accomplished it.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Projet d'inventaire Ville de Montréal (2024)
No de spécimen : CG2788
Date : 18 sept. 2024
Station : Parc Angrignon
Écologie : Sur bois pourri et décortiqué de feuillu. Agent de carie brune.
Partenaires de terrain : Janie Poitras
Récolté par : Chantal Gauthier
Déterminé par : Chantal Gauthier
Collectionné par : Chantal Gauthier
Description :
Très léger.
Chapeau 9 cm de largeur, 6 cm de projection et 2 cm d'épaisseur au point d'attache. Velouté à pubescent, de couleur chamois, blanchâtre teinté de bleu vers la marge. Bleui au froissement.
Pores 4 par mm, rond puis irrégulier à presque dédaloides
Couche de tubes 6 mm d'épaisseur.
Contexte 6 mm d'épaisseur, uniforme, blanchâtre, mou, spongieux..
Sporée bleu gris visible sur le substrat.
Microscopie :
Spores inamyloides, lisses, hyalines, surtout 4,4 x 1,1 µm.
Note :
Bien qu'on le dit solitaire, nous avons trouvé plusieurs spécimens sur le même substrat.
Clé # 462 MQ ;
1-spores inamyloides
2-spores plus courtes et moins larges pour C. livens (4,78 x 1,28 µm) que pour C. simulans (5,24 x 1,46 μm).
CM24-19679
www.inaturalist.org/observations/249699627
DNA Barcode ITS :
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATATTTGAAGGGGTTGTTGCTGGTCTCTAGCGGGACATCGTGCACGCCTCGTTCAAAAATCCAACCTTTACACCCCTGTGCATCATTTGTAGGGTTGCGGCCGTCAGGCTTGCGCTCTATGTTTATCACAAACTCTGTAGTATGTGTAGAATGACATTGCGTATAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATCATCAACTCTCATTTCTTTTTCAGAGATGAGAGCTTGGACTTGGAGGTCTCTGCTGGCTTTTCGTGCCGGCTCCTCTTGAATGCATTAGCTTGAACCTTTGCTGTATCGGCCTCGGTGTGATAATTGTCTACGCCGTGGCTGTGAGGCTCATTTTAAACGGGCTCAGCTTCCAATGGTCTGCTTGCGGACAACATCTCATTGACCTCTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTT
100% match (adj for 1 polymorphic locus) with Danny Miller's MG137082.1 (HOLOTYPE)
MycoMap BLAST Results :
mycomap.com/genetics/blast-search/h02-cm24-19679-inat2496...
Trace Files (Raw DNA Data) :
mycomap.com/genetics/sequences/ont_sequences/h02-cm24-196...
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Inside view @ Faliro in Greece, 2011
Design + construction: Werner Maritsas
Materials: plywood + metal
Dimensions 2.50X2.50X2.55
learn pore here: wernermaritsas.wordpress.com/
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
The Polymorphic Plastic Parade (Tipi tour 09), www.plasticparade.org/ came to Austin. The members of the project had a discussion about the project at the MASS Gallery.
This was very interesting. It was a great idean and I enjoyed discovering how the idea came about and how they accomplished it.
Horse Meadow Campground, Tulare County. Polymorphic population, this year there was a higher frequency of the yellow form.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Highdown Gardens near Worthing, West Sussex ...
Caltha palustris, known as Marsh Marigold and Kingcup, is a perennial herbaceous plant of the family Ranunculaceae, native to marshes, fens, ditches and wet woodland in temperate regions of the Northern Hemisphere.
It becomes most luxuriant in partial shade. It is rare on peat. In the United Kingdom, it is probably one of the most ancient native plants, surviving the glaciations and flourishing after the last retreat of the ice, in a landscape inundated with glacial melt waters.
The flowers are yellow, with 4-9 (mostly 5) petal-like sepals and many yellow stamens. They appear in early spring to late summer. The flowers are visited by a great variety of insects for pollen and for the nectar secreted from small depressions, one on each side of each carpel. Hoverflies, bees, butterflies and dragonflies love the flowers.
Carpels form into green sac-like follicles to 1 cm long, each opening to release several seeds.
Caltha palustris is a highly polymorphic species, showing continuous and independent variation in many features. Forms in the UK may be divided into two subspecies: Caltha palustris subsp. palustris, and Caltha palustris subsp. minor.
It is sometimes considered a weed in clay-like garden soils, where every piece of its root will survive and spread. In warm free-draining soils, it simply dies away. It grows well as a pond marginal, or in the water with up to 4" of water above the basket.
As is the case with many members of the family Ranunculaceae, all parts of the plant are poisonous and can be irritant. Skin rashes and dermatitis have been reported from excessive handling of the plant. It is known to sometimes kill cows and will happily grow in cow manure.
Butterflies have a four-stage life cycle, as like most insects they undergo complete metamorphosis. Winged adults lay eggs on the food plant on which their larvae, known as caterpillars, will feed. The caterpillars grow, sometimes very rapidly, and when fully developed, pupate in a chrysalis. When metamorphosis is complete, the pupal skin splits, the adult insect climbs out, and after its wings have expanded and dried, it flies off. Some butterflies, especially in the tropics, have several generations in a year, while others have a single generation, and a few in cold locations may take several years to pass through their entire life cycle.
Butterflies are often polymorphic, and many species make use of camouflage, mimicry, and aposematism to evade their predators.[1] Some, like the monarch and the painted lady, migrate over long distances. Many butterflies are attacked by parasites or parasitoids, including wasps, protozoans, flies, and other invertebrates, or are preyed upon by other organisms. Some species are pests because in their larval stages they can damage domestic crops or trees; other species are agents of pollination of some plants. Larvae of a few butterflies (e.g., harvesters) eat harmful insects, and a few are predators of ants, while others live as mutualists in association with ants. Culturally, butterflies are a popular motif in the visual and literary arts. The Smithsonian Institution says "butterflies are certainly one of the most appealing creatures in nature".[2]
Photographed on Matiu Somes Island Wellington New Zealand.
A species of wader in the Haematopodidae family. It is endemic to New Zealand. The Maori name is torea-pango. They are also known as 'red bills'. "Variable" refers to the frontal plumage, which ranges from pied through mottled to all black. They are polymorphic meaning they have different genetic variants. Blacker birds are more common in the south. All Stewart Island variable oystercatchers are black. They have pink legs, an orange eye ring and red beaks. They are often seen in pairs on the coast all around New Zealand. During breeding, the pair will defend their territory, sometimes aggressively. Once mated pairs rarely divorce. After breeding they may be seen within flocks, or on the edges of flocks, of black and white South Island Pied Oystercatcher (SIPO) which also have vivid orange beaks. After breeding they may even form small flocks of their own. Males are around 678 grams and females slightly larger at around 724 grams.
Sinónimo de Viburnum betulifolium, pero diferente. Esta es una de las especies más polimórficas, quizás incluyendo muchas razas geográficas. Existe un patrón de variación muy complicado entre las diferentes razas geográficas en la ausencia o presencia y densidad de la pubescencia en la yema de invierno, el tubo del cáliz y la corola, y en el tamaño de la corola y el fruto, en la textura y forma de la hoja, en presencia o ausencia de pubescencia en la superficie de la hoja adaxial, y en presencia o ausencia de puntos glandulares y de pubescencia estrellada en la superficie de la hoja abaxial. Por tanto, es muy difÃcil identificar las diferentes razas geográficas. En iturraran se encuentra en la zona 3.
Synonym of Viburnum betulifolium, but different. This is a most polymorphic species, perhaps including many geographic races. There exists a very complicated variation pattern among the different geographic races in the absence or presence and density of the pubescence on the winter bud, calyx tube, and corolla, and in the size of the corolla and fruit, in the texture and shape of the leaf, in the presence or absence of pubescence on the adaxial leaf surface, and in the presence or absence of glandular dots and of stellate pubescence on the abaxial leaf surface. Thus, it is very difficult to identify the different geographic races. In iturraran is found in area 3.
Paper mulberry
Cat 2 Invasive""Varies: hydric - mesic
Smooth, light brown, gaining vertical shallow furrows with maturity.Deciduous"Complexity: Simple
Arrangement: Varies: alternate, opposite, and whorled.
Shape: Polymorphic.
Margins: Serrate
Venation: sub-palmate""Thick pubescence on leaves, petitoles, and new stem growth. (Morus rubra will only have pubescence on leaves.)
Sap is milky colored
Leaves large."Aggressive colonizer.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Cavansite, whose name is derived from its chemical composition, calcium vanadium silicate, is a deep blue hydrous calcium vanadium phyllosilicate mineral, occurring as a secondary mineral in basaltic and andesitic rocks along with a variety of zeolite minerals. Discovered in 1967 in Malheur County, Oregon, cavansite is a relatively rare mineral. It is polymorphic with the even rarer mineral, pentagonite. It is most frequently found in Poona, India and in the Deccan Traps, a large igneous province.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Horse Meadow Campground, Tulare County. Polymorphic population, this year there was a higher frequency of the yellow form.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Horse Meadow Campground, Tulare County. Polymorphic population, this year there was a higher frequency of the yellow form.
Impact event crystallization from living Siphonophore or Chondrophore (Cnidarian Hydrozoa medusa jelly) Marine Invertebrate. This is not Silicate Quartz material. Paragonal.
Euxoa sp. see note below
Sample ID: BIOUG45533-F01
Process ID: RWWC2030-19
Project: RWWC
Institution Storing: Centre for Biodiversity Genomics
Field ID: 5458
wingspan ± 36 mm
Date: August 18, 2018
Locality: Coastal SW Washington State at the edge of Willapa Bay geo:lat=46 37.273 geo:lon=-123 56.814
BOLD notes this specimen of the highly polymorphic genus and thus matches closely the following species of Euxoa
Euxoa ridingsiana [30]
Euxoa wilsoni [28]
Euxoa flavicollis [11]
Euxoa perpolita [7]
Euxoa taura [6]
Euxoa maimes [6]
Euxoa aberrans [6]
Euxoa perolivalis [6]
Euxoa nomas [4]
Euxoa riversii [4]
Euxoa tristis [2]
Euxoa montana [2]
Euxoa manitobana [2]
Euxoa subconspicua [1]
Euxoa macrodent