View allAll Photos Tagged sequencer
Psytrance and techno gathering in Philadelphia, Pennsylvania, USA on 12/13/14.
Photos by Kyle Rober / Fractaltirbe
KyleRober7@gmail.com
www.facebook.com/thefractaltribenetwork
www.facebook.com/events/579338935505503
Atmosphere by John t Howell
VJ by Eduardo Danger Danger
Sound by
Yeah, so he didn't make it, but it's the first and only "proper" sequences I've ever shot... etc etc.
Expectorated Sequence @ Les Katacombes - Montréal - february 19th
More pics of that show on www.metaluniverse.net/compterendu/categories.php?cat_id=2203
17-55 2.8 + 430 EX
See time lapse videos at this link:
www.youtube.com/user/WildsidePhotography/search?query=tim...
animal, animal behavior, wildlife, fauna, insect, hymenoptera, vespidae, eumenidae, eumeninae, wasp, solitary wasp, mud dauber wasp, thread-waisted wasp, potter, potter wasp, black mud dauber, delta pyriforme, caterpillar, nest, mud nest, pot, parasitoid, parasite, prey, predator, mud, reproduction, perak, malaysia, asia, timelapse, time lapse, sequence, june 2021
CG2534
29 juillet 2022, Ripon, Outaouais.
Forêt de feuillu, près d'une souche.
Chapeau 6 cm. de diam.
Lames adnées, uncinées, espacées.
Pied élargi à la base, avec pseudorhize.
Note; le pied est écrasé car j'ai tenu le spécimen entre les doigts pendant un bon moment.
Exsiccata de couleur orangé.
Spores finement rugueuses avec appendice hilaire
Me; 19,7 x 11,1 µm
Q; 1,7
D'abord identifié comme H. megalospora par la grandeur des spores. Ici, la longueur moyenne de 19,7 µm nous dirigeait vers H. megalospora alors que H. limonispora M : 16,4 µm.
GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAAACTCTGAACGCTTGCGGCTTCACTTCTGCTGCTGACGCCTAGGCGTATGTGCACGTTTGAAGTCGCTTGCCTCTTCTTTGTTCCACCTGTGCACCTTTTGTAGATCTGGTTAGGAAGCTCACTTACTAAGTGGTTTGAAGGGTTTGCTTGACGCTCCCTTTGTCCTCCAGGTCTATGCTTTATCATCTCTTGTATGTCTAGAATGTCTTGTTTTATGGGACTTCACCGTCCTTTAAAAAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCAGTAAATTCTCAACCCTTCTTAGCTTTTCGTTAAGGATGGGATTGGATGTGGAGGCTTGCCGGACGTCAACGTTCAGCTCCTCTGAAATGCATTAGCAGTACGACCATTACTTGGGCTACGCTAAGCTGTGATAATATCTAAGCTAGCTTGGTTCAGAGTGTTGGCAGAGCTCGGGTTTTTTGAAGGGTGCTTCGCGGCTCCCTTTGTGTTCTCTCTTCTTGAGAGATACCTATGCGACTCTGTGAAAGGTTTTGTTACCGCTTCTAACCGTCTTCTGACAACCTTAACTGATTATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT
Provisional Species Name :
Oudemansiella limonispora
MycoMap BLAST Results :
mycomap.com/genetics/blast-search/g07-cm24-20975-inat2518...
Trace Files (Raw DNA Data) :
mycomap.com/genetics/sequences/ont_sequences/g07-cm24-209...
www.inaturalist.org/observations/251801302
Ma séquence est 99.7% identique à H. limonispora GQ913403 et à 97% de H. megalospora GQ913418 utilisées dans l'article de Liu et al. (2023).
REFERENCE :
A new species and new records of Hymenopellis and Xerula (Agaricales, Physalacriaceae) from China
Liu et al. (2023)
PeerJ Life and Environment
Fund Finance Asssociation's 8th Annual Global Fund Finance Symposium in New York City. (Photo: www.JeffreyHolmes.com)
I designed a Spore creature while I was at E3, and the nice people at EA were kind enough to make it into a little 3-D figurine like the ones they had sitting around their booth and ship it to me. It has two heads, one bird-like and the other more like a moose, with large fighting arms.
Это не фотки, а стоп-кадры с кинокамеры.
Видеооператор Владимир Кольцов
Видеомонтаж Владимир Кольцов
superoperator.ru
Sony PMW-F3 + Angenieux Optimo DP Rouge 30-80mm T2.8 Zoom Lens
None of the F3 footage in this set has been color-graded, filtered, or otherwise manipulated in post.
Circular Oscillator
This unit is one of the latest rarities of Zebranalogic. It's designed to be played horisontally. It comes with 2 Vco's, in different tones of frequency, low to high. It has 4 Lfo's implemented in different tempo, and a envelope filter which makes it possible to generate exquisite tones. It comes with a five channel mixer, in which two channels are used by the envelope filter and the three others are free for additional mixing.
This unit has a Stereo Output and comes with a 110ac - 220ac Adaptor, 9 V dc. It has 1/8 inputs to be sent through any controller of 0 - 5 V or a Midi Cv. This unit can also be configured as you can see on the video, via patches. You can play it aleatorically or in an ordered form, without risk of it being damaged.
-This unit comes with Midi (in/thru).
-Lfo 4 output through each lfo triangular and square output 1/8.
-Envelope filter inputs for controls 1/8.
- vco output 1/8 square wave shape.
-output 1/8 sawtooth wave shape.
-input 1/8 to control the lfo or any cv transmitor up to 5 V inputs 1/8 for retroalimentation of the vco.
-3 independent inputs 1/8 for alternate combinations.
-This unit comes with 5 plug/plug 1/8.
-master volume and Stereo Output.
Muur rond het Marine Etablissement, Kattenburgerstraat, Amsterdam.
Wall around the Naval Barracks, Kattenburgerstraat, Amsterdam
© All rights reserved Tutti i diritti riservati. www.fotomiglio.com
Ph. Riccardo Migliorini
Canon EOS 1D Mark II
Every bulb turns on and out one by one in sequence like snow fall, richer colors, very beautiful.
var addthis_config = "data_track_clickback":false,"data_track_addressbar":false,"data_track_textcopy":false,"ui_atversion":"300";
var addthis_product = 'wpp-4.0';
news.jgstore.com/led-meteor-shower-lights-waterproof-8-tu...