View allAll Photos Tagged bioinformatics
At the beginning of August, I was in Puerto Iguazu, Argentina for a week to teach a workshop on bioinformatics and genomics. Of course, I managed to do a little birding as well, and am slowly getting around to processing the pictures.
Here is the first shot from this trip, of a Squirrel Cuckoo. Not actually a new bird for the trip (I've seen them before in Costa Rica), but a species I was very happy to get a decent photo of.
Wild flowers grown for research at the National Botanic Gardens of Wales, as part of the Bar Coding Project. Quote: We are currently using Barcode UK to support our pollinator research, looking at where our honey bees are foraging, what plants hoverflies are visiting, as well as finding out the floral source of honeys. We are developing bioinformatic resources to support DNA barcoding. Our DNA barcodes are also being used to understand pollen movement for hay fever sufferers and to help understand plant community structure."
The backside, as it were.
I've had a busy week of socializing, hosting prospective graduate students, preparing for lab meeting, bioinformatics, yadda yadda... I'm not sure of the current square tally, I'll get to that later. Right now I'm going grocery shopping.
I think this is the most important chart in technology business.
(It's an updated version of Ray Kurzweil's published work, posted with permission, and updated here through 2016. Further UPDATE here, post Tesla AI Day.)
In this abstraction of Moore’s Law, Kurzweil plots computational power on a logarithmic scale, and finds a double exponential curve that holds over 100 years (a straight line would represent a geometrically compounding curve of progress).
In the modern era of accelerating change in the tech industry, it is hard to find even five-year trends with any predictive value, let alone trends that span the centuries.
Ray argues that through five paradigm shifts – such as electro-mechanical calculators and vacuum tube computers – the computational power that $1000 buys has doubled every two years. For the past 30 years, it has been doubling every year.
Each dot is the frontier of computational price performance of the day. One machine was used in the 1890 Census; one cracked the Nazi Enigma cipher in World War II; one predicted Eisenhower’s win in the 1956 Presidential election.
Each dot represents a human drama. They did not realize that they were on a predictive curve. Each dot represents an attempt to build the best computer with the tools of the day. Of course, we use these computers to make better design software and manufacturing control algorithms. And so the progress continues.
Notice that the pace of innovation is exogenous to the economy. The Great Depression and the World Wars and various recessions do not introduce a meaningful change in the long-term trajectory of Moore’s Law. Certainly, the adoption rates, revenue, profits and economic fates of the computer companies behind the various dots on the graph may go though wild oscillations, but the long-term trend emerges nevertheless.
Any one technology, such as the CMOS transistor, follows an elongated S-shaped curve of slow progress during initial development, upward progress during a rapid adoption phase, and then slower growth from market saturation over time. But a more generalized capability, such as computation, storage, or bandwidth, tends to follow a pure exponential – bridging across a variety of technologies and their cascade of S-curves.
Moore’s Law is commonly reported as a doubling of transistor density every 18 months. But this is not something the co-founder of Intel, Gordon Moore, has ever said. It is a nice blending of his two predictions; in 1965, he predicted an annual doubling of transistor counts in the most cost effective chip and revised it in 1975 to every 24 months. With a little hand waving, most reports attribute 18 months to Moore’s Law, but there is quite a bit of variability. The popular perception of Moore’s Law is that computer chips are compounding in their complexity at near constant per unit cost. This is one of the many abstractions of Moore’s Law, and it relates to the compounding of transistor density in two dimensions. Others relate to speed (the signals have less distance to travel) and computational power (speed x density).
Unless you work for a chip company and focus on fab-yield optimization, you do not care about transistor counts. Integrated circuit customers do not buy transistors. Consumers of technology purchase computational speed and data storage density. When recast in these terms, Moore’s Law is no longer a transistor-centric metric, and this abstraction allows for longer-term analysis.
What Moore observed in the belly of the early IC industry was a derivative metric, a refracted signal, from the bigger trend, the trend that begs various philosophical questions and predicts mind-bending futures.
Moore’s Law is a primary driver of disruptive innovation, such as the iPod usurping the Sony Walkman franchise , and it drives not only IT and Communications and has become the primary driver in drug discovery and bioinformatics, medical imaging and diagnostics. As Moore’s Law crosses critical thresholds, a formerly lab science of trial and error experimentation becomes a simulation science and the pace of progress accelerates dramatically, creating opportunities for new entrants in new industries.
This non-linear pace of progress has been the primary juggernaut of perpetual market disruption, spawning wave after wave of opportunities for new companies.
I just watched Transcendent Man, so I have Kurzweil on the mind.
NOTE: this is a semi-log graph, so a straight line is an exponential; each y-axis tick is 100x. This graph covers a 100,000,000,000,000,000,000x improvement in computation/$.
I have color coded it to show the transition among the integrated circuit architectures. I also added the current NVIDIA workhorses — the A100 and H100. You can see how the mantle of Moore's Law has transitioned most recently from the GPU (green dots) to the ASIC (yellow and orange dots), and the H100 itself is a transitionary species — from GPU to ASIC, with 8-bit performance optimized for AI models. Remember, there are thousands of invisible dots below the frontier of humanity's capacity to compute (e.g., everything from Intel in the past 13 years).
Tesla DOJO's dominance should not be a surprise, as Intel ceded leadership to NVIDIA a decade ago, and further handoffs were inevitable. The computational frontier has shifted across many technology substrates over the past 120 years, most recently from the CPU to the GPU to ASICs optimized for neural networks (the majority of new compute cycles).
Of all of the depictions of Moore’s Law, this is the one (originally by Ray Kurzweil) that I find to be the most useful, as it captures what customers actually value — computation per constant dollar.
Humanity’s capacity to compute has compounded for as long as we can measure it, exogenous to the economy, and starting long before Intel co-founder Gordon Moore noticed a refraction of the longer-term trend in the belly of the fledgling semiconductor industry in 1965.
Why the transition within the integrated circuit era? Intel lost to NVIDIA for neural networks because the fine-grained parallel compute architecture of a GPU maps better to the needs of deep learning. There is a poetic beauty to the computational similarity of a processor optimized for graphics processing and the computational needs of a sensory cortex, as commonly seen in neural networks today. A custom chip (like the Tesla D1 ASIC) optimized for neural networks extends that trend to its inevitable future in the digital domain. Further advances are possible in analog in-memory compute, an even closer biomimicry of the human cortex. The best business planning assumption is that Moore’s Law, as depicted here, will continue for the next 20 years as it has for the past 120.
For those unfamiliar with this chart, here is a more detailed description:
Moore's Law is both a prediction and an abstraction
Moore’s Law is commonly reported as a doubling of transistor density every 18 months. But this is not something the co-founder of Intel, Gordon Moore, has ever said. It is a nice blending of his two predictions; in 1965, he predicted an annual doubling of transistor counts in the most cost effective chip and revised it in 1975 to every 24 months. With a little hand waving, most reports attribute 18 months to Moore’s Law, but there is quite a bit of variability. The popular perception of Moore’s Law is that computer chips are compounding in their complexity at near constant per unit cost. This is one of the many abstractions of Moore’s Law, and it relates to the compounding of transistor density in two dimensions. Others relate to speed (the signals have less distance to travel) and computational power (speed x density).
Unless you work for a chip company and focus on fab-yield optimization, you do not care about transistor counts. Integrated circuit customers do not buy transistors. Consumers of technology purchase computational speed and data storage density. When recast in these terms, Moore’s Law is no longer a transistor-centric metric, and this abstraction allows for longer-term analysis.
What Moore observed in the belly of the early IC industry was a derivative metric, a refracted signal, from a longer-term trend, a trend that begs various philosophical questions and predicts mind-bending futures.
Ray Kurzweil’s abstraction of Moore’s Law shows computational power on a logarithmic scale, and finds a double exponential curve that holds over 120 years! A straight line would represent a geometrically compounding curve of progress.
Through five paradigm shifts – such as electro-mechanical calculators and vacuum tube computers – the computational power that $1000 buys has doubled every two years. For the past 35 years, it has been doubling every year.
Each dot is the frontier of computational price performance of the day. One machine was used in the 1890 Census; one cracked the Nazi Enigma cipher in World War II; one predicted Eisenhower’s win in the 1956 Presidential election. Many of them can be seen in the Computer History Museum.
Each dot represents a human drama. Prior to Moore’s first paper in 1965, none of them even knew they were on a predictive curve. Each dot represents an attempt to build the best computer with the tools of the day. Of course, we use these computers to make better design software and manufacturing control algorithms. And so the progress continues.
Notice that the pace of innovation is exogenous to the economy. The Great Depression and the World Wars and various recessions do not introduce a meaningful change in the long-term trajectory of Moore’s Law. Certainly, the adoption rates, revenue, profits and economic fates of the computer companies behind the various dots on the graph may go though wild oscillations, but the long-term trend emerges nevertheless.
Any one technology, such as the CMOS transistor, follows an elongated S-shaped curve of slow progress during initial development, upward progress during a rapid adoption phase, and then slower growth from market saturation over time. But a more generalized capability, such as computation, storage, or bandwidth, tends to follow a pure exponential – bridging across a variety of technologies and their cascade of S-curves.
In the modern era of accelerating change in the tech industry, it is hard to find even five-year trends with any predictive value, let alone trends that span the centuries. I would go further and assert that this is the most important graph ever conceived.
Why is this the most important graph in human history?
A large and growing set of industries depends on continued exponential cost declines in computational power and storage density. Moore’s Law drives electronics, communications and computers and has become a primary driver in drug discovery, biotech and bioinformatics, medical imaging and diagnostics. As Moore’s Law crosses critical thresholds, a formerly lab science of trial and error experimentation becomes a simulation science, and the pace of progress accelerates dramatically, creating opportunities for new entrants in new industries. Boeing used to rely on the wind tunnels to test novel aircraft design performance. Ever since CFD modeling became powerful enough, design moves to the rapid pace of iterative simulations, and the nearby wind tunnels of NASA Ames lie fallow. The engineer can iterate at a rapid rate while simply sitting at their desk.
Every industry on our planet is going to become an information business. Consider agriculture. If you ask a farmer in 20 years’ time about how they compete, it will depend on how they use information, from satellite imagery driving robotic field optimization to the code in their seeds. It will have nothing to do with workmanship or labor. That will eventually percolate through every industry as IT innervates the economy.
Non-linear shifts in the marketplace are also essential for entrepreneurship and meaningful change. Technology’s exponential pace of progress has been the primary juggernaut of perpetual market disruption, spawning wave after wave of opportunities for new companies. Without disruption, entrepreneurs would not exist.
Moore’s Law is not just exogenous to the economy; it is why we have economic growth and an accelerating pace of progress. At Future Ventures, we see that in the growing diversity and global impact of the entrepreneurial ideas that we see each year. The industries impacted by the current wave of tech entrepreneurs are more diverse, and an order of magnitude larger than those of the 90’s — from automobiles and aerospace to energy and chemicals.
At the cutting edge of computational capture is biology; we are actively reengineering the information systems of biology and creating synthetic microbes whose DNA is manufactured from bare computer code and an organic chemistry printer. But what to build? So far, we largely copy large tracts of code from nature. But the question spans across all the complex systems that we might wish to build, from cities to designer microbes, to computer intelligence.
Reengineering engineering
As these systems transcend human comprehension, we will shift from traditional engineering to evolutionary algorithms and iterative learning algorithms like deep learning and machine learning. As we design for evolvability, the locus of learning shifts from the artifacts themselves to the process that created them. There is no mathematical shortcut for the decomposition of a neural network or genetic program, no way to "reverse evolve" with the ease that we can reverse engineer the artifacts of purposeful design. The beauty of compounding iterative algorithms (evolution, fractals, organic growth, art) derives from their irreducibility. And it empowers us to design complex systems that exceed human understanding.
Why does progress perpetually accelerate?
All new technologies are combinations of technologies that already exist. Innovation does not occur in a vacuum; it is a combination of ideas from before. In any academic field, the advances today are built on a large edifice of history. . This is why major innovations tend to be 'ripe' and tend to be discovered at the nearly the same time by multiple people. The compounding of ideas is the foundation of progress, something that was not so evident to the casual observer before the age of science. Science tuned the process parameters for innovation, and became the best method for a culture to learn.
From this conceptual base, come the origin of economic growth and accelerating technological change, as the combinatorial explosion of possible idea pairings grows exponentially as new ideas come into the mix (on the order of 2^n of possible groupings per Reed’s Law). It explains the innovative power of urbanization and networked globalization. And it explains why interdisciplinary ideas are so powerfully disruptive; it is like the differential immunity of epidemiology, whereby islands of cognitive isolation (e.g., academic disciplines) are vulnerable to disruptive memes hopping across, much like South America was to smallpox from Cortés and the Conquistadors. If disruption is what you seek, cognitive island-hopping is good place to start, mining the interstices between academic disciplines.
It is the combinatorial explosion of possible innovation-pairings that creates economic growth, and it’s about to go into overdrive. In recent years, we have begun to see the global innovation effects of a new factor: the internet. People can exchange ideas like never before Long ago, people were not communicating across continents; ideas were partitioned, and so the success of nations and regions pivoted on their own innovations. Richard Dawkins states that in biology it is genes which really matter, and we as people are just vessels for the conveyance of genes. It’s the same with ideas or “memes”. We are the vessels that hold and communicate ideas, and now that pool of ideas percolates on a global basis more rapidly than ever before.
In the next 6 years, three billion minds will come online for the first time to join this global conversation (via inexpensive smart phones in the developing world). This rapid influx of three billion people to the global economy is unprecedented in human history, and so to, will the pace of idea-pairings and progress.
We live in interesting times, at the cusp of the frontiers of the unknown and breathtaking advances. But, it should always feel that way, engendering a perpetual sense of future shock.
He got 89% in school and got a place at TNAU in Btech Bioinformatics. A good cricketer, basketball player and a 800m sprinter too.
“A General Electric Missile and Space Department artist brings to life scientists’ visualization of the lunar city of the next century. As the drawing indicates, the lunar city would be a combined complex of surface and underground activity with modern moon men living mainly below the surface, protected from the extreme temperatures and dangerous cosmic rays.
At the extreme top left is the nuclear power station. To its right are ore and rock mines which will tap the anticipated mineral wealth of the moon. At top center is a large industrial complex which processes the ore into liquid hydrogen, oxygen and other substances necessary for maintenance of the lunar city.
Hovering overhead in the lunar sky is the moon orbiting station which serves as a transfer point for passengers shuttling between earth and moon. At the right upper center is a large lunar spaceport. The smooth landing surface is made of pulverized moon rock and man-made binder.
Inside the hollowed-out lunar city at lower left is a moving sidewalk which carries pedestrians at speeds up to 15 miles an hour. It is shown radiating out in three spokes from the balloon-like hub. The tall slab-like structures in the upper part of the city housing units. The rectangular dome-topped structure directly to the right is the moon university. Beneath the large dome at the left center of the city is a scientific research center. The dome at right houses moon farms for the growing of fruit and vegetables in a carefully simulated “earth” environment.
A park with an art gallery surrounding the central fountain is at the lower portion of the city center. To its left a moon citizen is shown hovering in a one-man winged “transport” made possible because of the moon’s low gravitational pull. Sets of high-intensity floodlights which recreate earth daylight in the cave lunar city are shown at various points of the cut-out drawing.
On the moon surface, at extreme lower right, is an astronomical observatory which will be able to view the heavens without the obstructed atmosphere of earth. Above the observatory is a roving moon vehicle. At right center is a complex radio antenna for the radio astronomical observation of the universe. To its left is the covered moving pedestrian sidewalk that brings the earth traveler from the spaceport to the subterranean lunar city.”
7.25" x 8.625". Although no watermark is visible, the paper has the thick, heavy "A KODAK PAPER" look & feel to it.
Online color versions of this image are spectacular.
And, as if all that wasn’t enough, there’s the following. Ostensibly?/Apparently? written by the artist himself, Roy Scarfo. Wonderful:
“ADVANCED LUNAR CITY
TheFutureinSpace is not only the science of future space travel, or building colonies and cities on other planets, but it is also about the development of the sciences here on Earth that are needed to get us there, live there, and survive there. In the case of the Advanced Lunar City, the political and sociological sciences will play a heavy part.
In early 1967 I received a call from The New York Times in reference to an article that Isaac Asimov had written about a possible lunar colony. Asimov, at that time, was an associate professor of biochemistry at the medical school of Boston University, and he had recently published his 80th book ranging from history and mathematics to science and science fiction. The title of his article was “After Apollo, A Colony on the Moon.” The Times asked me to read the article and to advise them of the possibilities of an illustration to accompany it. After doing so, I saw the chance to incorporate many concepts I had on a lunar colony into one large illustration.
I accepted the commission. I made several calls to Asimov, and we discussed the illustration. I received a green light from The Times to proceed with pencil roughs using my own imagination as to what the lunar colony would look like. At this point in time, a trip to the moon with three astronauts was still in the NASA planning stages. After about 50 pencil roughs, I realized I had enough material to create a full size city on the moon – not just a colony.
I called The Times in New York City and set up a meeting with Mike O’Keefe, my contact at The Times, and his editor of the magazine section. I was excited with the pencil roughs I had in my portfolio, but as I sat in the train on my way to the big city, I thought maybe I went to far with my concepts (which was a normal reaction to my work at that time).
Well, The Times people loved it, my worries were calmed. I received the OK to proceed with a pencil comprehensive for a full page in full color for The Times Magazine section. Traveling home on the train I thought of additional concepts I could include in the illustration, such as lunarites flying around the lunar city which could be made possible because of the low lunar gravity. I thought I’ve taken the whole concept this far, I’ll go for the brass ring!
I finished the pencil comp and returned to The Times, flying people and all, and they bought off on the whole concept. I could have flown home myself!
So what started as a lunar colony was now an advanced lunar city.
The lunar city I envisioned was mainly below the surface, where an atmosphere like Earth’s could be created, safe from the extremes of temperature and cosmic rays. The main source of power would be a nuclear power station (1) that would be capable of supplying all of the city’s energy needs. Mines would be drilled and blasted out of the lunar mountains (2) and the ore would be transported to an industrial complex (3) where it would be processed into liquid hydrogen, oxygen, and other minerals. I placed an orbiting space station (4) in a lunar orbit which would be used as a transfer point for travelers between Earth and the lunar city. A large lunar space port (5) would be constructed from a composition of crushed lunar rock combined with a binder. The moving sidewalks (6) would be divided into three belts, each moving at a five mph difference (5mph, 10mph, and 15 mph). Lunarites and visitors, depending upon how fast they need to reach their destination, would step from one belt to the other. I would stay on the 5 mph belt which would give me the time to enjoy the lunar splendor looking out through the transparent walkways.
Apartments and condominiums (7) would house the permanent residents (lunarites). The residences would be equipped with the most advanced conveniences, such as self-cleaning dishes and carpets, bathrooms that stay clean, windows that never get dirty, and programmable paint that changes color with one click, all made possible through nanotechnology. 3-D TV screens in each apartment would keep lunarites in contact with family and friend back on Earth.
A medical center is shown (8) with the latest medical equipment that science can provide.
A lunar university (9) would provide an education in astronomy and the space sciences that no university on Earth could match because of the moon’s non-existing atmosphere. A radio antenna (10) would provide scientists and students with a clear listening post for the study of the galaxy and the communications with other worlds. The research center (11) would also have laboratories in the lunar orbiting station where they could develop and communicate new knowledge in biotechnology, nanotechnology, bioinformatics, and a host of other sciences. The farming of fruits, vegetables, and other foods (12) will be accomplished in a completely controlled environment.
Strap on your wings and sail (13) for entertainment or transportation. This should be possible because of the Moon’s gravitational pull.
I could not have completed this piece without an art gallery (14) placed in a park setting. Not only would the space art of lunarites be on exhibit, but also 3-D art and holography.
At about this point I started to think about sports, which was almost my downfall. How far could you hit a baseball? Throw a football? How high should a basketball hoop be? Next thought - running? Jumping? Gymnastics? My next thought – “Lunar Olympics”! (15) that would bring people from every corner of the earth to the Moon. I became so engrossed with the concept I stopped work on the Advanced Lunar City and started sketches of an Olympic City on the Moon. I obtained field specifications for many of the sports from the Olympic Committee and started working with engineers on what the fields and arenas would be like on the Moon. I created many sketches, but I had to stop. My mind was boggled, but more important, I had to finish the Advanced Lunar City illustration.
I have never gone back to those sketches. I did express this concept to the people at The Times, and they were very interested in the piece, but I was too involved at the time with other projects. I still think of visitors in spaceships from many countries landing at the lunar spaceport on their way to the Lunar Olympics in the Advanced Lunar City.
Banks of lighting fixtures (16) would be built into the ceiling of the underground facility and would be controlled by a central plant. An astronomical observatory (17) would provide perfect viewing of the galaxy. And finally, what would life be like without getting into the family lunar rover (18) and going for a Sunday drive?
All the technology needed to build this advanced lunar city exists today. Will the Lunar City ever be built? Count on it!!
The full page Advanced Lunar City appeared in the May 28, 1967, issue in Section 6 of the New York Times Magazine on page 31. The original illustration now hangs on the walls of Columbia University in New York City, presented to them on behalf of my son Gunny, who graduated in 1999.”
Above at:
thefutureinspace.com/blog/index.cfm?section=blog&fuse...
Credit: BEYOND TOMORROW/Roy Scarfo blogsite? A wonderful & insightful site with LOTS of amazing works by Mr. Scarfo! If only they were of higher resolution. Not complaining, merely wishful thinking.
Finally, a subsequent, ‘religiously correct’, although glaringly, not racially correct version:
believermag.com/the-chapel-on-the-moon/
Credit: “THE BELIEVER” magazine? website
Wonderful, at the always wonderful "Dreams of Space - Books and Ephemera" website:
4.bp.blogspot.com/-KfdP9OEQOLw/T-tnRek2bKI/AAAAAAAADUk/jT...
Credit: John Sisson
Last, but NOT least:
m.youtube.com/watch?v=VDcalR4BoGw&feature=youtu.be
Credit: FLYPMedia/YouTube
...while keeping your supercool… and harnessing the refractive echoes of many trillions of parallel universes engaged in the computation…
D-Wave’s quantum annealing paper came out in Nature today (here's a plain English summary).
“Fabricated using standard integrated circuit processes, the processors tested contained 128 superconducting flux qubits and 24,000 devices known as Josephson junctions, making them among the most complex superconducting circuits ever built. Designed to solve optimization and sampling problems, the processors have been successfully used in a variety of tasks including financial risk analysis, bioinformatics, affinity mapping and sentiment analysis, object recognition in images, medical imaging classification and compressed sensing.”
It also makes a wicked machine learning coprocessor, as shown by Google.
Image courtesy of D-Wave. The brilliant monitoring squares are comb-meanders, and the wiring spacing forms a diffraction grating tuned to a specific wavelength of light.
A bioinformatics scientist using AI to develop models for protein function and genomics. I spent a week as official photographer at the IUPESM World Congress - Adelaide - 2025.
Got to love my Sigma 100-300 f4 and my K1ii low light capability. It felt like I was shooting TED talks
This is the most difficult speaking event, by far, that I take on, and somehow I keep coming back.
Just spank me with that red paddle!
Five panelists are asked to come up with two tech trends that we think are worthy of the top 10 title, and that are, as they instruct:
1) Not obvious today
2) You believe there will be explosive growth in about five years’ time
When you do this for many years, it gets harder and harder. For several years now, I have done this, and have to come up with new ones each year. If it's too obvious, it's boring. If it's too radical, it might not be relevant over the next five years. And it had to be important and new... worthy of a top 10 tech trend.
So, here are the 10 trends...
What do you think? Which do you agree most with? Disagree most with? Think are too obvious?
Trend 1. Radical Globalization of Social Commerce (Kevin Efrusy)
In prior cycles, international segments consisted of 30-40 percent of revenue, begun 3-5 years after the US effort. Going forward, "ROW" can dominate domestic, and players who wait to address it are vulnerable to competitors who go global first.
Trend 2. Zero Marginal Cost Education (Bing Gordon)
In the 1970s, ATMs were considered “dehumanizing” and bank tellers were the gold standard. But tellers got worse, while ATMs improved. Public education seems to be repeating this pattern, and the oligopolists of “big education” don’t seem to have read Innovator’s Dilemma.
Trend 3. Massive Sensors and Data (Reid Hoffman)
Sensors cost trends to zero; there are sensors everywhere and part of everything. In combination, we'll create multiple data collections that power applications and innovations to improve our lives. Genetics, disease, and symptom data for automate tri-corders, precision diagnosis, and personalized medicine. Collaborative filtering of all kinds of discovery– from music to information to professional training.
Trend 4. All Vehicles Go Electric (Steve Jurvetson)
Eventually all motor vehicles will transition to an electric drive train, affording greater efficiency, convenience, and a multitude of new design options. Within five years, this inevitability will become clear. ([it got heated at times; here is a short video clip of Peter Thiel's reaction.)
Trend 5. A Shift Toward Technocracy: Doing More with Less (Peter Thiel)
Democrats want government to do more with more. Republicans say government should do less with less. Technology might allow it to do more with less.
Trend 6. It's Just the Venture Cycle (Kevin Efrusy)
The fortunes of Silicon Valley rarely mirror the rest of the world because the ebb and flow of creative disruption follows a different pattern and 14-16 year cycle than the macro economy. We appear to be right on schedule...
Trend 7. Gamification of Everything (Bing Gordon)
As Lance Armstrong wrote, “Every second counts.” As digital natives increasingly multi-task, and as the social web creates geometric growth in posts, the battle is for engagement. For the growing population of game-players, reportedly 70% of Americans, games are important systems for creating meaning, and can increase behavior by 25 to 100%.
Trend 8. The New Hardware: Bits to Atoms (Reid Hoffman)
Open Source patterns now applied to hardware. Collective design bases with rapid modifications. Flexible manufacturing producing limited run and unique devices. 3D printing means revolution in custom and unique goods. Ultimately, revolutions in biological and medical products and solutions.
Trend 9. Moore's Law Accelerates Beyond Silicon (Steve Jurvetson)
When we consider Moore’s Law in the abstract, the dropping cost of computation is not tapering off. Rather it will accelerate further still as we look beyond the silicon era.
Trend 10. The Beginnings of Bioinformatics; Intelligent Design Over Random Drug Discovery (Peter Thiel)
More powerful computers will turn biology into an information science.
Some screenshots from a tool that I am building to visualize flue genomic data.
Some screenshots from a tool that I am building to visualize flue genomic data.
For more information, read this blog post:
blog.blprnt.com/blog/blprnt/open-science-h1n1-processing-...
I was discussing H1N1 with a bioinformatics friend of mine last weekend, and we ended up talking about ways that epidemiologists model transmission of disease. I wondered how some of the information that is shared voluntarily on social networks might be used to build useful models of various kinds.
I'm also interested in visualizing information that isn't implicitly shared - but instead is inferred or suggested.
This piece looks for tweets containing the phrases 'just landed in...' or 'just arrived in...'. Locations from these tweets are located using MetaCarta's Location Finder API. The home location for the traveling users are scraped from their Twitter pages. The system then plots these voyages over time.
I'm not entirely sure where this will end up going, but I am reasonably happy with the results so far.
Built with Processing (processing.org)
You can read more about this project on my blog - blog.blprnt.com
When the BICC Building was built 25 years ago, it was innovative in a couple ways. It housed people using cutting edge technology to study bioinformatics (biological data and genetic code) and the building itself was ahead of it's time in terms of architecture. Using a lot of concrete/metals, clean lines, and open spaces, the design is not only visually appealing but also stout in construction.
This concrete grid extends from the fifth floor up over stairs below. While it doesn't appear to have any structural significance, it does lend itself to the overall character of the building.
Image with my Hasselblad 500cm.
Primary Colours:
1. Chemistry (the science of matter) red
2. Biology (the science of life) green
3. Informatics (the science of information) blue
Secondary colours:
1. Biochemistry (the chemistry of life) yellow
2. Bioinformatics (the science of biological information) cyan
3. Cheminformatics (the science of chemical information) magenta
If you use good quality colours, you should get brilliant white when you mix them... but it doesn't always work that way... sometimes you get a muddy brown colour.
Taken from Defrosting the Digital Library (Slideshow)
I was discussing H1N1 with a bioinformatics friend of mine last weekend, and we ended up talking about ways that epidemiologists model transmission of disease. I wondered how some of the information that is shared voluntarily on social networks might be used to build useful models of various kinds.
I'm also interested in visualizing information that isn't implicitly shared - but instead is inferred or suggested.
This piece looks for tweets containing the phrases 'just landed in...' or 'just arrived in...'. Locations from these tweets are located using MetaCarta's Location Finder API. The home location for the traveling users are scraped from their Twitter pages. The system then plots these voyages over time.
I'm not entirely sure where this will end up going, but I am reasonably happy with the results so far.
Built with Processing (processing.org)
You can read more about this project on my blog - blog.blprnt.com
In the 11 February 2011 issue, Science provides a broad look at the issues surrounding the increasingly huge influx of research data. This collection of articles highlights both the challenges posed by the data deluge and the opportunities that can be realized if we can better organize and access the data.
The Science cover features a word cloud generated from all of the content from the magazine's special section.
www.sciencemag.org/content/331/6018.cover-expansion
A word cloud generated from all of the content from the Dealing with Data special section beginning on p. 692. The size of each word relates to the frequency with which it appears in the combined texts. References and figure legends were included; common words, authors, and affiliations were excluded. All words are lowercase. See an expanded version of this cloud and other features at www.sciencemag.org/special/data/. Credit: Yael Fitzpatrick, using www.wordle.net
Original version (11MB) at www.sciencemag.org/site/special/data/ScienceData-hi.pdf
World leader, scientist, medical scientist, virologist, pharmacist, Professor Fangruida (F.D Smith) on the world epidemic and the nemesis and prevention of new coronaviruses and mutant viruses (Jacques Lucy) 2021v1.5)
_-----------------------------------------
The Nemesis and Killer of New Coronavirus and Mutated Viruses-Joint Development of Vaccines and Drugs (Fangruida) July 2021
*The particularity of new coronaviruses and mutant viruses*The broad spectrum, high efficiency, redundancy, and safety of the new coronavirus vaccine design and development , Redundancy and safety
*New coronavirus drug chemical structure modification*Computer-aided design and drug screening. *"Antiviral biological missile", "New Coronavirus Anti-epidemic Tablets", "Composite Antiviral Oral Liquid", "New Coronavirus Long-acting Oral Tablets", "New Coronavirus Inhibitors" (injection)
——————————————————————————
(World leader, scientist, medical scientist, biologist, virologist, pharmacist, FD Smith) "The Nemesis and Killer of New Coronavirus and Mutated Viruses-The Joint Development of Vaccines and Drugs" is an important scientific research document. Now it has been revised and re-published by the original author several times. The compilation is published and published according to the original manuscript to meet the needs of readers and netizens all over the world. At the same time, it is also of great benefit to the vast number of medical clinical drug researchers and various experts and scholars. We hope that it will be corrected in the reprint.------Compiled by Jacques Lucy in Geneva, August 2021
-------------------------------------------------- ---------------------
According to Worldometer's real-time statistics, as of about 6:30 on July 23, there were a total of 193,323,815 confirmed cases of new coronary pneumonia worldwide, and a total of 4,150,213 deaths. There were 570,902 new confirmed cases and 8,766 new deaths worldwide in a single day. Data shows that the United States, Brazil, the United Kingdom, India, and Indonesia are the five countries with the largest number of new confirmed cases, and Indonesia, Brazil, Russia, South Africa, and India are the five countries with the largest number of new deaths.
The new coronavirus and delta mutant strains have been particularly serious in the recent past. Many countries and places have revived, and the number of cases has not decreased, but has increased.
, It is worthy of vigilance. Although many countries have strengthened vaccine prevention and control and other prevention and control measures, there are still many shortcomings and deficiencies in virus suppression and prevention. The new coronavirus and various mutant strains have a certain degree of antagonism to traditional drugs and most vaccines. Although most vaccines have great anti-epidemic properties and have important and irreplaceable effects and protection for prevention and treatment, it is impossible to completely prevent the spread and infection of viruses. The spread of the new crown virus pneumonia has been delayed for nearly two years. There are hundreds of millions of people infected worldwide, millions of deaths, and the time is long, the spread is widespread, and billions of people around the world are among them. The harm of the virus is quite terrible. This is well known. of. More urgent
What is more serious is that the virus and mutant strains have not completely retreated, especially many people are still infected and infected after being injected with various vaccines. The effectiveness of the vaccine and the resistance of the mutant virus are worthy of medical scientists, virologists, pharmacologists Zoologists and others seriously think and analyze. The current epidemic situation in European and American countries, China, Brazil, India, the United States, Russia and other countries has greatly improved from last year. However, relevant figures show that the global epidemic situation has not completely improved, and some countries and regions are still very serious. In particular, after extensive use of various vaccines, cases still occur, and in some places they are still very serious, which deserves a high degree of vigilance. Prevention and control measures are very important. In addition, vaccines and various anti-epidemic drugs are the first and necessary choices, and other methods are irreplaceable. It is particularly important to develop and develop comprehensive drugs, antiviral drugs, immune drugs, and genetic drugs. Research experiments on new coronaviruses and mutant viruses require more rigorous and in-depth data analysis, pathological pathogenic tissues, cell genes, molecular chemistry, quantum chemistry, etc., as well as vaccine molecular chemistry, quantum physics, quantum biology, cytological histology, medicinal chemistry, and drugs And the vaccine’s symptomatic, effectiveness, safety, long-term effectiveness, etc., of course, including tens of thousands of clinical cases and deaths and other first-hand information and evidence. The task of RNA (ribonucleic acid) in the human body is to use the information of our genetic material DNA to produce protein. It accomplishes this task in the ribosome, the protein-producing area of the cell. The ribosome is the place where protein biosynthesis occurs.
Medicine takes advantage of this: In vaccination, artificially produced mRNA provides ribosomes with instructions for constructing pathogen antigens to fight against—for example, the spike protein of coronavirus.
Traditional live vaccines or inactivated vaccines contain antigens that cause the immune system to react. The mRNA vaccine is produced in the cell
(1) The specificity of new coronaviruses and mutant viruses, etc., virology and quantum chemistry of mutant viruses, quantum physics, quantum microbiology
(2) New crown vaccine design, molecular biology and chemical structure, etc.
(3) The generality and particularity of the development of new coronavirus drugs
(4) Various drug design for new coronavirus pneumonia, medicinal chemistry, pharmacology, etc., cells, proteins, DNA, enzyme chemistry, pharmaceutical quantum chemistry, pharmaceutical quantum physics, human biochemistry, human biophysics, etc.
(5) The evolution and mutation characteristics of the new coronavirus and various mutant viruses, the long-term nature, repeatability, drug resistance, and epidemic resistance of the virus, etc.
(6) New coronavirus pneumonia and the infectious transmission of various new coronaviruses and their particularities
(7) The invisible transmission of new coronavirus pneumonia and various mutant viruses in humans or animals, and the mutual symbiosis of cross infection of various bacteria and viruses are also one of the very serious causes of serious harm to new coronaviruses and mutant viruses. Virology, pathology, etiology, gene sequencing, gene mapping, and a large number of analytical studies have shown that there are many cases in China, the United States, India, Russia, Brazil, and other countries.
(8) For the symptomatic prevention and treatment of the new coronavirus, the combination of various vaccines and various antiviral drugs is critical.
(9) According to the current epidemic situation and research judgments, the epidemic situation may improve in the next period of time and 2021-2022, and we are optimistic about its success. However, completely worry-free, it is still too early to win easily. It is not just relying on vaccination. Wearing masks to close the city and other prevention and control measures and methods can sit back and relax, and you can win a big victory. Because all kinds of research and exploration still require a lot of time and various experimental studies. It is not a day's work. A simple taste is very dangerous and harmful. The power and migratory explosiveness of viruses sometimes far exceed human thinking and perception. In the future, next year, or in the future, whether viruses and various evolutionary mutation viruses will re-attack, we still need to study, analyze, prevent and control, rather than being complacent, thinking that the vaccine can win a big victory is inevitably naive and ridiculous. Vaccine protection is very important, but it must not be taken carelessly. The mutation of the new crown virus is very rampant, and the cross-infection of recessive and virulent bacteria makes epidemic prevention and anti-epidemic very complicated.
(10) New crown virus pneumonia and the virus's stubbornness, strength, migration, susceptibility, multi-infectiousness, and occult. The effectiveness of various vaccines and the particularity of virus mutations The long-term hidden dangers and repeated recurrences of the new coronavirus
(11) The formation mechanism and invisible transmission of invisible viruses, asymptomatic infections and asymptomatic infections, asymptomatic transmission routes, asymptomatic infections, pathological pathogens. The spread and infection of viruses and mutated viruses, the blind spots and blind spots of virus vaccines, viral quantum chemistry and
The chemical and physical corresponding reactions at the meeting points of highly effective vaccine drugs, etc. The variability of mutated viruses is very complicated, and vaccination cannot completely prevent the spread of infection.
(12) New crown virus pneumonia and various respiratory infectious diseases are susceptible to infections in animals and humans, and are frequently recurring. This is one of the frequently-occurring and difficult diseases of common infectious diseases. Even with various vaccines and various antiviral immune drugs, it is difficult to completely prevent the occurrence and spread of viral pneumonia. Therefore, epidemic prevention and anti-epidemic is a major issue facing human society, and no country should take it lightly. The various costs that humans pay on this issue are very expensive, such as Ebola virus, influenza A virus,
Hepatitis virus,
Marburg virus
Sars coronavirus, plague, anthracnose, cholera
and many more. The B.1.1.7 mutant virus that was first discovered in the UK was renamed Alpha mutant virus; the B.1.351 that was first discovered in South Africa was renamed Beta mutant virus; the P.1 that was first discovered in Brazil was renamed Gamma mutant virus; the mutation was first discovered in India There are two branches of the virus. B.1.617.2, which was listed as "mutated virus of concern", was renamed Delta mutant virus, and B.1.617.1 of "mutated virus to be observed" was renamed Kappa mutant virus.
However, experts in many countries believe that the current vaccination is still effective, at least it can prevent severe illness and reduce deaths.
Delta mutant strain
According to the degree of risk, the WHO divides the new crown variant strains into two categories: worrying variant strains (VOC, variant of concern) and noteworthy variant strains (VOI, variant of interest). The former has caused many cases and a wide range of cases worldwide, and data confirms its transmission ability, strong toxicity, high power, complex migration, and high insidious transmission of infection. Resistance to vaccines may lead to the effectiveness of vaccines and clinical treatments. Decrease; the latter has confirmed cases of community transmission worldwide, or has been found in multiple countries, but has not yet formed a large-scale infection. Need to be very vigilant. Various cases and deaths in many countries in the world are related to this. In some countries, the epidemic situation is repeated, and it is also caused by various reasons and viruses, of course, including new cases and so on.
At present, VOC is the mutant strain that has the greatest impact on the epidemic and the greatest threat to the world, including: Alpha, Beta, Gamma and Delta. , Will the change of the spur protein in the VOC affect the immune protection effect of the existing vaccine, or whether it will affect the sensitivity of the VOC to the existing vaccine? For this problem, it is necessary to directly test neutralizing antibodies, such as those that can prevent the protection of infection. Antibodies recognize specific protein sequences on viral particles, especially those spike protein sequences used in mRNA vaccines.
(13) Countries around the world, especially countries and regions with more severe epidemics, have a large number of clinical cases, severe cases, and deaths, especially including many young and middle-aged patients, including those who have been vaccinated. The epidemic is more complicated and serious. Injecting various vaccines, taking strict control measures such as closing the city and wearing masks are very important and the effect is very obvious. However, the new coronavirus and mutant viruses are so repeated, their pathological pathogen research will also be very complicated and difficult. After the large-scale use of the vaccine, many people are still infected. In addition to the lack of prevention and control measures, it is very important that the viability of the new coronavirus and various mutant viruses is very important. It can escape the inactivation of the vaccine. It is very resistant to stubbornness. Therefore, the recurrence of new coronavirus pneumonia is very dangerous. What is more noteworthy is that medical scientists, virologists, pharmacists, biologists, zoologists and clinicians should seriously consider the correspondence between virus specificity and vaccine drugs, and the coupling of commonality and specificity. Only in this way can we find targets. Track and kill viruses. Only in this sense can the new crown virus produce a nemesis, put an end to and eradicate the new crown virus pneumonia. Of course, this is not a temporary battle, but a certain amount of time and process to achieve the goal in the end.
(14) The development and evolution of the natural universe and earth species, as well as life species. With the continuous evolution of human cell genes, microbes and bacterial viruses are constantly mutated and inherited. The new world will inevitably produce a variety of new pathogens.
And viruses. For example, neurological genetic disease, digestive system disease, respiratory system disease, blood system disease, cardiopulmonary system disease, etc., new diseases will continue to emerge as humans develop and evolve. Human migration to space, space diseases, space psychological diseases, space cell diseases, space genetic diseases, etc. Therefore, for the new coronavirus and mutated viruses, we must have sufficient knowledge and response, and do not think that it will be completely wiped out.
, And is not a scientific attitude. Viruses and humans mutually reinforce each other, and viruses and animals and plants mutually reinforce each other. This is the iron law of the natural universe. Human beings can only adapt to natural history, but cannot deliberately modify natural history.
Active immune products made from specific bacteria, viruses, rickettsiae, spirochetes, mycoplasma and other microorganisms and parasites are collectively called vaccines. Vaccination of animals can make the animal body have specific immunity. The principle of vaccines is to artificially attenuate, inactivate, and genetically attenuate pathogenic microorganisms (such as bacteria, viruses, rickettsia, etc.) and their metabolites. Purification and preparation methods, made into immune preparations for the prevention of infectious diseases. In terms of ingredients, the vaccine retains the antigenic properties and other characteristics of the pathogen, which can stimulate the body's immune response and produce protective antibodies. But it has no pathogenicity and does not cause harm to the body. When the body is exposed to this pathogen again, the immune system will produce more antibodies according to the previous memory to prevent the pathogen from invading or to fight against the damage to the body. (1) Inactivated vaccines: select pathogenic microorganisms with strong immunogenicity, culture them, inactivate them by physical or chemical methods, and then purify and prepare them. The virus species used in inactivated vaccines are generally virulent strains, but the use of attenuated attenuated strains also has good immunogenicity, such as the inactivated polio vaccine produced by the Sabin attenuated strain. The inactivated vaccine has lost its infectivity to the body, but still maintains its immunogenicity, which can stimulate the body to produce corresponding immunity and resist the infection of wild strains. Inactivated vaccines have a good immune effect. They can generally be stored for more than one year at 2~8°C without the risk of reversion of virulence; however, the inactivated vaccines cannot grow and reproduce after entering the human body. They stimulate the human body for a short time and must be strong and long-lasting. In general, adjuvants are required for immunity, and multiple injections in large doses are required, and the local immune protection of natural infection is lacking. Including bacteria, viruses, rickettsiae and toxoid preparations.
(2) Live attenuated vaccine: It is a vaccine made by using artificial targeted mutation methods or by screening live microorganisms with highly weakened or basically non-toxic virulence from the natural world. After inoculation, the live attenuated vaccine has a certain ability to grow and reproduce in the body, which can cause the body to have a reaction similar to a recessive infection or a mild infection, and it is widely used.
(3) Subunit vaccine: Among the multiple specific antigenic determinants carried by macromolecular antigens, only a small number of antigenic sites play an important role in the protective immune response. Separate natural proteins through chemical decomposition or controlled proteolysis, and extract bacteria and virusesVaccines made from fragments with immunological activity are screened out of the special protein structure of, called subunit vaccines. Subunit vaccines have only a few major surface proteins, so they can eliminate antibodies induced by many unrelated antigens, thereby reducing the side effects of the vaccine and related diseases and other side effects caused by the vaccine. (4) Genetically engineered vaccine: It uses DNA recombination biotechnology to direct the natural or synthetic genetic material in the pathogen coat protein that can induce the body's immune response into bacteria, yeast or mammalian cells to make it fully expressed. A vaccine prepared after purification. The application of genetic engineering technology can produce subunit vaccines that do not contain infectious substances, stable attenuated vaccines with live viruses as carriers, and multivalent vaccines that can prevent multiple diseases. This is the second-generation vaccine following the first-generation traditional vaccine. It has the advantages of safety, effectiveness, long-term immune response, and easy realization of combined immunization. It has certain advantages and effects.
New coronavirus drug development, drug targets and chemical modification.
Ligand-based drug design (or indirect drug design planning) relies on the knowledge of other molecules that bind to the target biological target. These other molecules can be used to derive pharmacophore models and structural modalities, which define the minimum necessary structural features that the molecule must have in order to bind to the target. In other words, a model of a biological target can be established based on the knowledge of the binding target, and the model can be used to design new molecular entities and other parts that interact with the target. Among them, the quantitative structure-activity relationship (QSAR) is included, in which the correlation between the calculated properties of the molecule and its experimentally determined biological activity can be derived. These QSAR relationships can be used to predict the activity of new analogs. The structure-activity relationship is very complicated.
Based on structure
Structure-based drug design relies on knowledge of the three-dimensional structure of biological targets obtained by methods such as X-ray crystallography or NMR spectroscopy and quantum chemistry. If the experimental structure of the target is not available, it is possible to create a homology model of the target and other standard models that can be compared based on the experimental structure of the relevant protein. Using the structure of biological targets, interactive graphics and medical chemists’ intuitive design can be used to predict drug candidates with high affinity and selective binding to the target. Various automatic calculation programs can also be used to suggest new drug candidates.
The current structure-based drug design methods can be roughly divided into three categories. The 3D method is to search a large database of small molecule 3D structures to find new ligands for a given receptor, in order to use a rapid approximate docking procedure to find those suitable for the receptor binding pocket. This method is called virtual screening. The second category is the de novo design of new ligands. In this method, by gradually assembling small fragments, a ligand molecule is established within the constraints of the binding pocket. These fragments can be single atoms or molecular fragments. The main advantage of this method is that it can propose novel structures that are not found in any database. The third method is to optimize the known ligand acquisition by evaluating the proposed analogs in the binding cavity.
Bind site ID
Binding site recognition is a step in structure-based design. If the structure of the target or a sufficiently similar homologue is determined in the presence of the bound ligand, the ligand should be observable in that structure, in which case the location of the binding site is small. However, there may not be an allosteric binding site of interest. In addition, only apo protein structures may be available, and it is not easy to reliably identify unoccupied sites that have the potential to bind ligands with high affinity. In short, the recognition of binding sites usually depends on the recognition of pits. The protein on the protein surface can hold molecules the size of drugs, etc. These molecules also have appropriate "hot spots" that drive ligand binding, hydrophobic surfaces, hydrogen bonding sites, and so on.
Drug design is a creative process of finding new drugs based on the knowledge of biological targets. The most common type of drug is small organic molecules that activate or inhibit the function of biomolecules, thereby producing therapeutic benefits for patients. In the most important sense, drug design involves the design of molecules with complementary shapes and charges that bind to their interacting biomolecular targets, and therefore will bind to them. Drug design often but does not necessarily rely on computer modeling techniques. A more accurate term is ligand design. Although the design technology for predicting binding affinity is quite successful, there are many other characteristics, such as bioavailability, metabolic half-life, side effects, etc., which must be optimized first before the ligand can become safe and effective. drug. These other features are usually difficult to predict and realize through reasonable design techniques. However, due to the high turnover rate, especially in the clinical stage of drug development, in the early stage of the drug design process, more attention is paid to the selection of drug candidates. The physical and chemical properties of these drug candidates are expected to be reduced during the development process. Complications are therefore more likely to lead to the approval of the marketed drug. In addition, in early drug discovery, in vitro experiments with computational methods are increasingly used to select compounds with more favorable ADME (absorption, distribution, metabolism, and excretion) and toxicological characteristics. A more accurate term is ligand design. Although the design technique for predicting binding affinity is quite successful, there are many other characteristics, such as bioavailability, metabolic half-life, side effects, iatrogenic effects, etc., which must be optimized first, and then the ligand To become safe and effective.
For drug targets, two aspects should be considered when selecting drug targets:
1. The effectiveness of the target, that is, the target is indeed related to the disease, and the symptoms of the disease can be effectively improved by regulating the physiological activity of the target.
2. The side effects of the target. If the regulation of the physiological activity of the target inevitably produces serious side effects, it is inappropriate to select it as the target of drug action or lose its important biological activity. The reference frame of the target should be expanded in multiple dimensions to have a big choice.
3. Search for biomolecular clues related to diseases: use genomics, proteomics and biochip technology to obtain biomolecular information related to diseases, and perform bioinformatics analysis to obtain clue information.
4. Perform functional research on related biomolecules to determine the target of candidate drugs. Multiple targets or individual targets.
5. Candidate drug targets, design small molecule compounds, and conduct pharmacological research at the molecular, cellular and overall animal levels.
Covalent bonding type
The covalent bonding type is an irreversible form of bonding, similar to the organic synthesis reaction that occurs. Covalent bonding types mostly occur in the mechanism of action of chemotherapeutic drugs. For example, alkylating agent anti-tumor drugs produce covalent bonding bonds to guanine bases in DNA, resulting in cytotoxic activity.
. Verify the effectiveness of the target.
Based on the targets that interact with drugs, that is, receptors in a broad sense, such as enzymes, receptors, ion channels, membranes, antigens, viruses, nucleic acids, polysaccharides, proteins, enzymes, etc., find and design reasonable drug molecules. Targets of action and drug screening should focus on multiple points. Drug intermediates and chemical modification. Combining the development of new drugs with the chemical structure modification of traditional drugs makes it easier to find breakthroughs and develop new antiviral drugs. For example, careful selection, modification and modification of existing related drugs that can successfully treat and recover a large number of cases, elimination and screening of invalid drugs from severe death cases, etc., are targeted, rather than screening and capturing needles in a haystack, aimless, with half the effort. Vaccine design should also be multi-pronged and focused. The broad-spectrum, long-term, safety, efficiency and redundancy of the vaccine should all be considered. In this way, it will be more powerful to deal with the mutation and evolution of the virus. Of course, series of vaccines, series of drugs, second-generation vaccines, third-generation vaccines, second-generation drugs, third-generation drugs, etc. can also be developed. Vaccines focus on epidemic prevention, and medicines focus on medical treatment. The two are very different; however, the two complement each other and complement each other. Therefore, in response to large-scale epidemics of infectious diseases, vaccines and various drugs are the nemesis and killers of viral diseases. Of course, it also includes other methods and measures, so I won't repeat them here.
Mainly through the comprehensive and accurate understanding of the structure of the drug and the receptor at the molecular level and even the electronic level, structure-based drug design and the understanding of the structure, function, and drug action mode of the target and the mechanism of physiological activity Mechanism-based drug design.
Compared with the traditional extensive pharmacological screening and lead compound optimization, it has obvious advantages.
Viral RNA replicase, also known as RNA-dependent RNA polymerase (RdRp) is responsible for the replication and transcription of RNA virus genome, and plays a very important role in the process of virus self-replication in host cells, and It also has a major impact on the mutation of the virus, it will change and accelerate the replication and recombination. Because RdRp from different viruses has a highly conserved core structure, the virus replicase is an important antiviral drug target and there are other selection sites, rather than a single isolated target target such as the new coronavirus As with various mutant viruses, inhibitors developed for viral replicase are expected to become a broad-spectrum antiviral drug. The currently well-known anti-coronavirus drug remdesivir (remdesivir) is a drug for viral replicase.
New antiviral therapies are gradually emerging. In addition to traditional polymerase and protease inhibitors, nucleic acid drugs, cell entry inhibitors, nucleocapsid inhibitors, and drugs targeting host cells are also increasingly appearing in the research and development of major pharmaceutical companies. The treatment of mutated viruses is becoming increasingly urgent. The development of drugs for the new coronavirus pneumonia is very important. It is not only for the current global new coronavirus epidemic, but more importantly, it is of great significance to face the severe pneumonia-respiratory infectious disease that poses a huge threat to humans.
There are many vaccines and related drugs developed for the new coronavirus pneumonia, and countries are vying for a while, mainly including the following:
Identification test, appearance, difference in loading, moisture, pH value, osmolality, polysaccharide content, free polysaccharide content, potency test, sterility test, pyrogen test, bacterial endotoxin test, abnormal toxicity test.
Among them: such as sterility inspection, pyrogen inspection, bacterial endotoxin, and abnormal toxicity inspection are indicators closely related to safety.
Polysaccharide content, free polysaccharide content, and efficacy test are indicators closely related to vaccine effectiveness.
Usually, a vaccine will go through a long research and development process of at least 8 years or even more than 20 years from research and development to marketing. The outbreak of the new crown epidemic requires no delay, and the design and development of vaccines is speeding up. It is not surprising in this special period. Of course, it is understandable that vaccine design, development and testing can be accelerated, shortened the cycle, and reduced some procedures. However, science needs to be rigorous and rigorous to achieve great results. The safety and effectiveness of vaccines are of the utmost importance. There must not be a single error. Otherwise, it will be counterproductive and need to be continuously improved and perfected.
Pre-clinical research: The screening of strains and cells is the basic guarantee to ensure the safety, effectiveness, and continuous supply of vaccines. Taking virus vaccines as an example, the laboratory stage needs to carry out strain screening, necessary strain attenuation, strain adaptation to the cultured cell matrix and stability studies in the process of passaging, and explore the stability of process quality, establish animal models, etc. . Choose mice, guinea pigs, rabbits or monkeys for animal experiments according to each vaccine situation. Pre-clinical research generally takes 5-10 years or longer on the premise that the process is controllable, the quality is stable, and it is safe and effective. In order to be safe and effective, a certain redundant design is also needed, so that the safety and effectiveness of the vaccine can be importantly guaranteed.
These include the establishment of vaccine strain/cell seed bank, production process research, quality research, stability research, animal safety evaluation and effectiveness evaluation, and clinical trial programs, etc.
The ARS-CoV-2 genome contains at least 10 ORFs. ORF1ab is converted into a polyprotein and processed into 16 non-structural proteins (NSP). These NSPs have a variety of functional biological activities, physical and chemical reactions, such as genome replication, induction of host mRNA cleavage, membrane rearrangement, autophagosome production, NSP polyprotein cleavage, capping, tailing, methylation, RNA double-stranded Uncoiling, etc., and others, play an important role in the virus life cycle. In addition, SARS-CoV-2 contains 4 structural proteins, namely spike (S), nucleocapsid (N), envelope (E) and membrane (M), all of which are encoded by the 3'end of the viral genome. Among the four structural proteins, S protein is a large multifunctional transmembrane protein that plays an important role in the process of virus adsorption, fusion, and injection into host cells, and requires in-depth observation and research.
1S protein is composed of S1 and S2 subunits, and each subunit can be further divided into different functional domains. The S1 subunit has 2 domains: NTD and RBD, and RBD contains conservative RBM. The S2 subunit has 3 structural domains: FP, HR1 and HR2. The S1 subunit is arranged at the top of the S2 subunit to form an immunodominant S protein.
The virus uses the host transmembrane protease Serine 2 (TMPRSS2) and the endosomal cysteine protease CatB/L to enter the cell. TMPRSS2 is responsible for the cleavage of the S protein to expose the FP region of the S2 subunit, which is responsible for initiating endosome-mediated host cell entry into it. It shows that TMPRSS2 is a host factor necessary for virus entry. Therefore, the use of drugs that inhibit this protease can achieve the purpose of treatment.
mRNA-1273
The mRNA encoding the full length of SARS-CoV-2, and the pre-spike protein fusion is encapsulated into lipid nanoparticles to form mRNA-1273 vaccine. It can induce a high level of S protein specific antiviral response. It can also consist of inactivated antigens or subunit antigens. The vaccine was quickly approved by the FDA and has entered phase II clinical trials. The company has announced the antibody data of 8 subjects who received different immunization doses. The 25ug dose group achieved an effect similar to the antibody level during the recovery period. The 100ug dose group exceeded the antibody level during the recovery period. In the 25ug and 100ug dose groups, the vaccine was basically safe and tolerable, while the 250ug dose group had 3 levels of systemic symptoms.
Viral vector vaccines can provide long-term high-level expression of antigen proteins, induce CTLs, and ultimately eliminate viral infections.
1, Ad5-nCov
A vaccine of SARS-CoV-2 recombinant spike protein expressed by recombinant, replication-deficient type 5 adenovirus (Ad5) vector. Load the optimized full-length S protein gene together with the plasminogen activation signal peptide gene into the E1 and E3 deleted Ad5 vectors. The vaccine is constructed by the Admax system derived from Microbix Biosystem. In phase I clinical trials, RBD (S1 subunit receptor binding domain) and S protein neutralizing antibody increased by 4 times 14 days after immunization, reaching a peak on 28 days. CD4+T and CD8+T cells reached a peak 14 days after immunization. The existing Ad5 immune resistance partially limits the response of antibodies and T cells. This study will be further conducted in the 18-60 age group, receiving 1/3 of the study dose, and follow-up for 3-6 months after immunization.
DNA vaccine
The introduction of antigen-encoding DNA and adjuvants as vaccines is the most innovative vaccine method. The transfected cells stably express the transgenic protein, similar to live viruses. The antigen will be endocytosed by immature DC, and finally provide antigen to CD4 + T, CD8 + T cells (by MHC differentiation) To induce humoral and cellular immunity. Some specificities of the virus and the new coronavirus mutant are different from general vaccines and other vaccines. Therefore, it is worth noting the gene expression of the vaccine. Otherwise, the effectiveness and efficiency of the vaccine will be questioned.
Live attenuated vaccine
DelNS1-SARS-CoV2-RBD
Basic influenza vaccine, delete NS1 gene. Express SARS-CoV-2 RBD domain. Cultured in CEF and MDCK (canine kidney cells) cells. It is more immunogenic than wild-type influenza virus and can be administered by nasal spray.
The viral genome is susceptible to mutation, antigen transfer and drift can occur, and spread among the population. Mutations can vary depending on the environmental conditions and population density of the geographic area. After screening and comparing 7,500 samples of infected patients, scientists found 198 mutations, indicating the evolutionary mutation of the virus in the human host. These mutations may form different virus subtypes, which means that even after vaccine immunization, viral infections may occur. A certain amount of increment and strengthening is needed here.
Inactivated vaccines, adenovirus vector vaccines, recombinant protein vaccines, nucleic acid vaccines, attenuated influenza virus vector vaccines, etc. According to relevant information, there are dozens of new coronavirus vaccines in the world, and more varieties are being developed and upgraded. Including the United States, Britain, China, Russia, India and other countries, there are more R&D and production units.
AZ vaccine
Modena vaccine
Lianya Vaccine
High-end vaccine
Pfizer vaccine
Pfizer-BioNTech
A large study found that the vaccine developed by Pfizer and German biotechnology company BioNTech is 95% effective in preventing COVID-19.
The vaccine is divided into two doses, which are injected every three weeks.
This vaccine uses a molecule called mRNA as its basis. mRNA is a molecular cousin of DNA, which contains instructions to build specific proteins; in this case, the mRNA in the vaccine encodes the coronavirus spike protein, which is attached to the surface of the virus and used to infect human cells. Once the vaccine enters the human body, it will instruct the body's cells to make this protein, and the immune system will learn to recognize and attack it.
Moderna
The vaccine developed by the American biotechnology company Moderna and the National Institute of Allergy and Infectious Diseases (NIAID) is also based on mRNA and is estimated to be 94.5% effective in preventing COVID-19.
Like Pfizer's vaccine, this vaccine is divided into two doses, but injected every four weeks instead of three weeks. Another difference is that the Moderna vaccine can be stored at minus 20 degrees Celsius instead of deep freezing like Pfizer vaccine. At present, the importance of one of the widely used vaccines is self-evident.
Oxford-AstraZeneca
The vaccine developed by the University of Oxford and the pharmaceutical company AstraZeneca is approximately 70% effective in preventing COVID-19-that is, in clinical trials, adjusting the dose seems to improve this effect.
In the population who received two high-dose vaccines (28 days apart), the effectiveness of the vaccine was about 62%; according to early analysis, the effectiveness of the vaccine in those patients who received the half-dose first and then the full-dose Is 90%. However, in clinical trials, participants taking half doses of the drug are wrong, and some scientists question whether these early results are representative.
Sinopharm Group (Beijing Institute of Biological Products, China)
China National Pharmaceutical Group Sinopharm and Beijing Institute of Biological Products have developed a vaccine from inactivated coronavirus (SARS-CoV-2). The inactivated coronavirus is an improved version that cannot be replicated.
Estimates of the effectiveness of vaccines against COVID-19 vary.
Gamaleya Institute
The Gamaleya Institute of the Russian Ministry of Health has developed a coronavirus vaccine candidate called Sputnik V. This vaccine contains two common cold viruses, adenoviruses, which have been modified so that they will not replicate in the human body; the modified virus also contains a gene encoding the coronavirus spike protein.
New crown drugs
There are many small molecule antiviral drug candidates in the clinical research stage around the world. Including traditional drugs in the past and various drugs yet to be developed, antiviral drugs, immune drugs, Gene drugs, compound drugs, etc.
(A) Molnupiravir
Molnupiravir is a prodrug of the nucleoside analog N4-hydroxycytidine (NHC), jointly developed by Merck and Ridgeback Biotherapeutics.
The positive rate of infectious virus isolation and culture in nasopharyngeal swabs was 0% (0/47), while that of patients in the placebo group was 24% (6/25). However, data from the Phase II/III study indicate that the drug has no benefit in preventing death or shortening the length of stay in hospitalized patients.
Therefore, Merck has decided to fully advance the research of 800mg molnupiravir in the treatment of patients with mild to moderate COVID-19.
(B) AT-527
AT-527 is a small molecule inhibitor of viral RNA polymerase, jointly developed by Roche and Atea. Not only can it be used as an oral therapy to treat hospitalized COVID-19 patients, but it also has the potential as a preventive treatment after exposure.
Including 70 high-risk COVID-19 hospitalized patients data, of which 62 patients' data can be used for virological analysis and evaluation. The results of interim virological analysis show that AT-527 can quickly reduce viral load. On day 2, compared with placebo, patients treated with AT-527 had a greater decline in viral load than the baseline level, and the continuous difference in viral load decline was maintained until day 8.
In addition, compared with the control group, the potent antiviral activity of AT-527 was also observed in patients with a baseline median viral load higher than 5.26 log10. When testing by RT-qPCR to assess whether the virus is cleared,
The safety aspect is consistent with previous studies. AT-527 showed good safety and tolerability, and no new safety problems or risks were found. Of course, there is still a considerable distance between experiment and clinical application, and a large amount of experimental data can prove it.
(C) Prokrutamide
Prokalamide is an AR (androgen receptor) antagonist. Activated androgen receptor AR can induce the expression of transmembrane serine protease (TMPRSS2). TMPRSS2 has a shearing effect on the new coronavirus S protein and ACE2, which can promote the binding of viral spike protein (S protein) to ACE, thereby promoting The virus enters the host cell. Therefore, inhibiting the androgen receptor may inhibit the viral infection process, and AR antagonists are expected to become anti-coronavirus drugs.
Positive results were obtained in a randomized, double-blind, placebo-controlled phase III clinical trial. The data shows that Prokalutamide reduces the risk of death in severely ill patients with new coronary disease by 92%, reduces the risk of new ventilator use by 92%, and shortens the length of hospital stay by 9 days. This shows that procrulamide has a certain therapeutic effect for patients with severe new coronary disease, which can significantly reduce the mortality of patients, and at the same time greatly reduce the new mechanical ventilation and shorten the patient's hospital stay.
With the continuous development of COVID-19 on a global scale, in addition to vaccines and prevention and control measures, we need a multi-pronged plan to control this disease. Oral antiviral therapy undoubtedly provides a convenient treatment option.
In addition, there are other drugs under development and experimentation. In dealing with the plague virus, in addition to the strict control of protective measures, it is very important that various efficient and safe vaccines and various drugs (including medical instruments, etc.) are the ultimate nemesis and killer of the virus.
(A) "Antiviral biological missiles" are mainly drugs for new coronaviruses and mutant viruses, which act on respiratory and lung diseases. The drugs use redundant designs to inhibit new coronaviruses and variant viruses.
(B) "New Coronavirus Epidemic Prevention Tablets" mainly use natural purified elements and chemical structure modifications.
(C) "Composite antiviral oral liquid" antiviral intermediate, natural antiviral plant, plus other preparations
(D) "New Coronavirus Long-acting Oral Tablets" Chemical modification of antiviral drugs, multiple targets, etc.
(E) "New Coronavirus Inhibitors" (injections) are mainly made of chemical drug structure modification and other preparations.
The development of these drugs mainly includes: drug target screening, structure-activity relationship, chemical modification, natural purification, etc., which require a lot of work and experimentation.
Humans need to vigorously develop drugs to deal with various viruses. These drugs are very important for the prevention and treatment of viruses and respiratory infectious diseases, influenza, pneumonia, etc.
The history of human development The history of human evolution, like all living species, will always be accompanied by the survival and development of microorganisms. It is not surprising that viruses and infectious diseases are frequent and prone to occur. The key is to prevent and control them before they happen.
This strain was first discovered in India in October 2020 and was initially called a "double mutant" virus by the media. According to the announcement by the Ministry of Health of India at the end of March this year, the "India New Coronavirus Genomics Alliance" composed of 10 laboratories found in samples collected in Maharashtra that this new mutant strain carries E484Q and L452R mutations. , May lead to immune escape and increased infectivity. This mutant strain was named B.1.617 by the WHO and was named with the Greek letter δ (delta) on May 31.
Shahid Jamil, the dean of the Trivedi School of Biological Sciences at Ashoka University in India and a virologist, said in an interview with the Shillong Times of India that this mutant strain called "double mutation" is not accurate enough. B. 1.617 contains a total of 15 mutations, of which 6 occur on the spike protein, of which 3 are more critical: L452R and E484Q mutations occur on the spike protein and the human cell "Angiotensin Converting Enzyme 2 (ACE2)" receptor In the bound region, L452R improves the ability of the virus to invade cells, and E484Q helps to enhance the immune escape of the virus; the third mutation P681R can also make the virus enter the cell more effectively. (Encyclopedia website)
There are currently dozens of antiviral COVID-19 therapies under development. The large drugmakers Merck and Pfizer are the closest to the end, as expected, a pair of oral antiviral COVID-19 therapies are undergoing advanced human clinical trials.
Merck's drug candidate is called monupiravir. It was originally developed as an influenza antiviral drug several years ago. However, preclinical studies have shown that it has a good effect on SARS and MERS coronavirus.
Monupiravir is currently undergoing in-depth large-scale Phase 3 human trials. So far, the data is so promising that the US government recently pre-ordered 1.7 million courses of drugs at a cost of $1.2 billion. If everything goes according to plan, the company hopes that the drug will be authorized by the FDA for emergency use and be on the market before the end of 2021.
Pfizer's large COVID-19 antiviral drug candidate is more unique. Currently known as PF-07321332, this drug is the first oral antiviral drug to enter human clinical trials, specifically targeting SARS-CoV-2.
Variant of Concern WHO Label First Detected in World First Detected in Washington State
B.1.1.7 Alpha United Kingdom, September 2020 January 2021
B.1.351 Beta South Africa, December 2020 February 2021
P.1 Gamma Brazil, April 2020 March 2021
B.1.617.2 Delta India, October 2020 April 2021
Although this particular molecule was developed in 2020 after the emergence of the new coronavirus, a somewhat related drug called PF-00835231 has been in operation for several years, targeting the original SARS virus. However, the new drug candidate PF-07321332 is designed as a simple pill that can be taken under non-hospital conditions in the initial stages of SARS-CoV-2 infection.
"The protease inhibitor binds to a viral enzyme and prevents the virus from replicating in the cell," Pfizer said when explaining the mechanism of its new antiviral drug. "Protease inhibitors have been effective in the treatment of other viral pathogens, such as HIV and hepatitis C virus, whether used alone or in combination with other antiviral drugs. Currently marketed therapeutic drugs for viral proteases are generally not toxic Therefore, such molecules may provide well-tolerated treatments against COVID-19."
Various studies on other types of antiviral drugs are also gaining momentum. For example, the new coronavirus pneumonia "antiviral biological missile", "new coronavirus prevention tablets", "composite antiviral oral liquid", "new coronavirus long-acting oral tablets", "new coronavirus inhibitors" (injections), etc., are worthy of attention. Like all kinds of vaccines, they will play a major role in preventing and fighting epidemics.
In addition, Japanese pharmaceutical company Shionoyoshi Pharmaceutical is currently conducting a phase 1 trial of a protease inhibitor similar to SARS-CoV-2. This is called S-217622, which is another oral antiviral drug, and hopes to provide people with an easy-to-take pill in the early stages of COVID-19. At present, the research and development of vaccines and various new crown drugs is very active and urgent. Time does not wait. With the passage of time, various new crown drugs will appear on the stage one after another, bringing the gospel to the complete victory of mankind.
The COVID-19 pandemic is far from over. The Delta mutant strain has quickly become the most prominent SARS-CoV-2 strain in the world. Although our vaccine is still maintained, it is clear that we need more tools to combat this new type of coronavirus. Delta will certainly not be the last new SARS-CoV-2 variant we encountered. Therefore, it is necessary for all mankind to persevere and fight the epidemic together.
Overcome illness and meet new challenges. The new crown epidemic and various mutated viruses are very important global epidemic prevention and anti-epidemic top priorities, especially for the current period of time. Vaccine injections, research and development of new drugs, strict prevention and control, wear masks, reduce gatherings, strictly control large gatherings, prevent the spread of various viruses Masks, disinfection and sterilization, lockdown of the city, vaccinations, accounting and testing are very important, but this does not mean that humans can completely overcome the virus. In fact, many spreading and new latently transmitted infections are still unsuccessful. There are detections, such as invisible patients, asymptomatic patients, migratory latent patients, new-onset patients, etc. The struggle between humans and the virus is still very difficult and complicated, and long-term efforts and exploration are still needed, especially for medical research on the new coronavirus. The origin of the disease, the course of the disease, the virus invaded The deep-level path and the reasons for the evolution and mutation of the new coronavirus and the particularity of prevention and treatment, etc.). Therefore, human beings should be highly vigilant and must not be taken lightly. The fierce battle between humans and various viruses must not be slackened. Greater efforts are needed to successfully overcome this pandemic, fully restore the normal life of the whole society, restore the normal production and work order, restore the normal operation of society, economy and culture, and give up food due to choking. Or eager for success, will pay a high price.
———————————————————————————————————————————————— ————
References References are made to web resources, and related images are from web resources and related websites.
Who official website UN .org www.gavi.org/ispe.org
Wikipedia, "The Lancet", "English Journal of Medicine", "Nature", "Science", "Journal of the American Medical Association", etc.
Learning from history: do not flatten the curve of antiviral research!
T Bobrowski, CC Melo-Filho, D Korn, VM Alves...-Drug discovery today, 2020-
A critical overview of computational approaches employed for COVID-19 drug discovery
EN Muratov, R Amaro, CH Andrade, N Brown...-Chemical Society..., 2021-pubs.rsc.org
Global Research Performance on COVID 19 in Dimensions Database
J Balasubramani, M Anbalagan-2021-researchgate.net
Adoption of a contact tracing app for containing COVID-19: a health belief model approach
M Walrave, C Waeterloos...- JMIR public health and..., 2020-publichealth.jmir.org
Prophylactic Treatment Protocol Against the Severity of COVID-19 Using Melatonin
N Charaa, M Chahed, H Ghedira...-Available at SSRN..., 2020-papers.ssrn.com
Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China, The Lancet
Transmission of 2019-nCoV Infection from an Asymptomatic Contact in Germany, New England Journal of Medicine
The actions of respiratory therapists facing COVID-19
Zhu Jiacheng-Respiratory Therapy, 2021-pesquisa.bvsalud.org
Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study, The Lancet
Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus–Infected Pneumonia in Wuhan, China, JAMA, February 7
Epidemiologic and Clinical Characteristics of Novel Coronavirus Infections Involving 13 Patients Outside Wuhan, China, JAMA
Delta variant triggers new phase in the pandemic | Science
science.sciencemag.org›
COVID vaccines slash viral spread – but Delta is an unknown
www.nature.com ›articles
Novel coronavirus pneumonia during ophthalmic surgery management strategy and recommendations
YH HUANG, SS LI, X YAO, YR YANG, DH QIN…-jnewmed.com
Delta variant: What is happening with transmission, hospital ...
Risk of long QT syndrome in novel coronavirus COVID-19
VN Oslopov, JV Oslopova, EV Hazova…-Kazan medical…, 2020-kazanmedjournal.ru
Study compares mRNA and adenovirus-based SARS-CoV-2 vaccines ...
First molecular-based detection of SARS-CoV-2 virus in the field-collected houseflies
A Soltani, M Jamalidoust, A Hosseinpour, M Vahedi...-Scientific Reports, 2021-nature.com
Covid 19 DELTA Variant Archives-Online essay writing service
sourceessay.com ›tag› covid-19-delta-variant
SARS-CoV-2 Delta variant Likely to become dominant in the ...
Compilation postscript
Once Fang Ruida's research literature on the new crown virus and mutant virus was published, it has been enthusiastically praised by readers and netizens in dozens of countries around the world, and has proposed some amendments and suggestions. Hope to publish a multilingual version of the book as an emergency To meet the needs of many readers around the world, in the face of the new crown epidemic and the prevention and treatment of various mutant viruses, including the general public, college and middle school students, medical workers, medical colleagues and so on. According to the English original manuscript, it will be re-compiled and published. Inconsistencies will be revised separately. Thank you very much.
Jacques Lucy, Geneva, Switzerland, August 2021
*********************************************************************
Leader mondial, scientifique, scientifique médical, virologue, pharmacien et professeur Fangruida (F.D Smith) sur l'épidémie mondiale et l'ennemi juré et la prévention des nouveaux coronavirus et virus mutants (Jacques Lucy 2021v1.5)
_-----------------------------------------
L'ennemi juré et le tueur du nouveau coronavirus et des virus mutés - Développement conjoint de vaccins et de médicaments (Fangruida) Juillet 2021
* La particularité des nouveaux coronavirus et des virus mutants * Le large spectre, la haute efficacité, la redondance et la sécurité de la conception et du développement du nouveau vaccin contre le coronavirus, Redondance et sécurité
Secretary-General António Guterres is in Pakistan to attend the International Conference on 40 Years of Hosting Afghan Refugees in Pakistan, which is being organized by the Government of Pakistan and the UN Refugee Agency (UNHCR).
The Secretary-General participated in a meeting with three generations of refugees from Afghanistan, Yemen and Tajikistan in Islamabad. Pakistan is currently the world’s second largest host of refugees.
Pictured is Zainab Maha Shah, a recipient of UNHCR's DAFI scholarship, during the meeting with the Secretary-General. Zainab is a student at the Quaid-e-Azam University (Bioinformatics degree) and dreams of pursuing her further studies at Yale University. She is inspired by UNHCR Special Envoy Angelina Jolie because of her commitment and contribution to the refugee cause. She wishes to become part of the UNHCR refugee volunteer network and support other refugees.
UN Photo/Mark Garten
16 February 2020
Islamabad, Pakistan
Photo # 838571
I was discussing H1N1 with a bioinformatics friend of mine last weekend, and we ended up talking about ways that epidemiologists model transmission of disease. I wondered how some of the information that is shared voluntarily on social networks might be used to build useful models of various kinds.
I'm also interested in visualizing information that isn't implicitly shared - but instead is inferred or suggested.
This piece looks for tweets containing the phrases 'just landed in...' or 'just arrived in...'. Locations from these tweets are located using MetaCarta's Location Finder API. The home location for the traveling users are scraped from their Twitter pages. The system then plots these voyages over time.
I'm not entirely sure where this will end up going, but I am reasonably happy with the results so far.
Built with Processing (processing.org)
You can read more about this project on my blog - blog.blprnt.com
Mingle Media TV and Red Carpet Report host Paige Sullivan were invited to come back and cover the 2nd Annual Rebels with a Cause Gala at Paramount Studios honoring Larry Ellison with Jimmy Kimmel hosting and special guest performances by Barry Manilow and Pharrell Williams. This event supports the lifesaving research of David B. Agus, M.D. at USC’s Center for Applied Molecular Medicine.
Get the Story from the Red Carpet Report Team, follow us on Twitter and Facebook at:
www.facebook.com/RedCarpetReportTV
www.youtube.com/MingleMediaTVNetwork
ABOUT THE USC CENTER FOR APPLIED MOLECULAR MEDICINE
The principal goal of the USC Center for Applied Molecular Medicine is the development of novel treatment strategies for cancer. The Center was implemented to enable a convergence of multiple disciplines to work on treatment and the care of patients with cancer. The program includes the clinical care of patients with cancer at the USC Westside Cancer Center in Beverly Hills and has team members with expertise spanning cancer biology, biochemistry, molecular biology, bioinformatics, computer science, electrical engineering, bioorganic chemistry, physics and applied mathematics. For information, visit camm.usc.edu/.
For more of Mingle Media TV’s Red Carpet Report coverage, please visit our website and follow us on Twitter and Facebook here:
www.facebook.com/minglemediatvnetwork
www.flickr.com/MingleMediaTVNetwork
Follow our host Paige Sullivan on Twitter at twitter.com/PaigeSull
www.arqueologiadelperu.com/study-adds-to-evidence-that-vi...
A new analysis supports the hypothesis that viruses are living entities that share a long evolutionary history with cells, researchers report. The study offers the first reliable method for tracing viral evolution back to a time when neither viruses nor cells existed in the forms recognized today, the researchers say.
The diverse physical attributes, genome sizes and lifestyles of viruses make them difficult to classify. A new study uses protein folds as evidence that viruses are living entities that belong on their own branch of the tree of life [Credit: Julie McMahon]
Until now, viruses have been difficult to classify, said University of Illinois crop sciences and Carl R. Woese Institute for Genomic Biology professor Gustavo Caetano-Anollés, who led the new analysis with graduate student Arshan Nasir. In its latest report, the International Committee on the Taxonomy of Viruses recognized seven orders of viruses, based on their shapes and sizes, genetic structure and means of reproducing.
"Under this classification, viral families belonging to the same order have likely diverged from a common ancestral virus," the authors wrote. "However, only 26 (of 104) viral families have been assigned to an order, and the evolutionary relationships of most of them remain unclear."
Part of the confusion stems from the abundance and diversity of viruses. Less than 4,900 viruses have been identified and sequenced so far, even though scientists estimate there are more than a million viral species. Many viruses are tiny -- significantly smaller than bacteria or other microbes -- and contain only a handful of genes. Others, like the recently discovered mimiviruses, are huge, with genomes bigger than those of some bacteria.
The new study focused on the vast repertoire of protein structures, called "folds," that are encoded in the genomes of all cells and viruses. Folds are the structural building blocks of proteins, giving them their complex, three-dimensional shapes. By comparing fold structures across different branches of the tree of life, researchers can reconstruct the evolutionary histories of the folds and of the organisms whose genomes code for them.
The researchers chose to analyze protein folds because the sequences that encode viral genomes are subject to rapid change; their high mutation rates can obscure deep evolutionary signals, Caetano-Anollés said. Protein folds are better markers of ancient events because their three-dimensional structures can be maintained even as the sequences that code for them begin to change.
Today, many viruses -- including those that cause disease -- take over the protein-building machinery of host cells to make copies of themselves that can then spread to other cells. Viruses often insert their own genetic material into the DNA of their hosts. In fact, the remnants of ancient viral infiltrations are now permanent features of the genomes of most cellular organisms, including humans. This knack for moving genetic material around may be evidence of viruses' primary role as "spreaders of diversity," Caetano-Anollés said.
A new study analyzes the distinct, three-dimensional structures found in proteins. These structures are called folds. Some folds are shared by all organisms, while others are unique to individual branches of the tree of life. Pictured here are folds found in viruses [Credit: Arshan Nasir]
The researchers analyzed all of the known folds in 5,080 organisms representing every branch of the tree of life, including 3,460 viruses. Using advanced bioinformatics methods, they identified 442 protein folds that are shared between cells and viruses, and 66 that are unique to viruses.
"This tells you that you can build a tree of life, because you've found a multitude of features in viruses that have all the properties that cells have," Caetano-Anollés said. "Viruses also have unique components besides the components that are shared with cells."
In fact, the analysis revealed genetic sequences in viruses that are unlike anything seen in cells, Caetano-Anollés said. This contradicts one hypothesis that viruses captured all of their genetic material from cells. This and other findings also support the idea that viruses are "creators of novelty," he said.
Using the protein-fold data available in online databases, Nasir and Caetano-Anollés used computational methods to build trees of life that included viruses.
The data suggest "that viruses originated from multiple ancient cells ... and co-existed with the ancestors of modern cells," the researchers wrote. These ancient cells likely contained segmented RNA genomes, Caetano-Anollés said.
The data also suggest that at some point in their evolutionary history, not long after modern cellular life emerged, most viruses gained the ability to encapsulate themselves in protein coats that protected their genetic payloads, enabling them to spend part of their lifecycle outside of host cells and spread, Caetano-Anollés said. The protein folds that are unique to viruses include those that form these viral "capsids."
"These capsids became more and more sophisticated with time, allowing viruses to become infectious to cells that had previously resisted them," Nasir said. "This is the hallmark of parasitism."
Some scientists have argued that viruses are nonliving entities, bits of DNA and RNA shed by cellular life. They point to the fact that viruses are not able to replicate (reproduce) outside of host cells, and rely on cells' protein-building machinery to function. But much evidence supports the idea that viruses are not that different from other living entities, Caetano-Anollés said.
"Many organisms require other organisms to live, including bacteria that live inside cells, and fungi that engage in obligate parasitic relationships -- they rely on their hosts to complete their lifecycle," he said. "And this is what viruses do."
The discovery of the giant mimiviruses in the early 2000s challenged traditional ideas about the nature of viruses, Caetano-Anollés said.
"These giant viruses were not the tiny Ebola virus, which has only seven genes. These are massive in size and massive in genomic repertoire," he said. "Some are as big physically and with genomes that are as big or bigger than bacteria that are parasitic."
Some giant viruses also have genes for proteins that are essential to translation, the process by which cells read gene sequences to build proteins, Caetano-Anollés said. The lack of translational machinery in viruses was once cited as a justification for classifying them as nonliving, he said.
"This is no more," Caetano-Anollés said. "Viruses now merit a place in the tree of life. Obviously, there is much more to viruses than we once thought."
The new findings appear in the journal Science Advances.Source: University of Illinois at Urbana-Champaign [September 25, 2015]
Katherine is an MBI student who was interviewed for the CS Department's blog and MBI web site.
Setup: 430EX + white shoot-through umbrella above camera right triggered with a CTR-301 (ebay) trigger.
Mingle Media TV and Red Carpet Report host Paige Sullivan were invited to come back and cover the 2nd Annual Rebels with a Cause Gala at Paramount Studios honoring Larry Ellison with Jimmy Kimmel hosting and special guest performances by Barry Manilow and Pharrell Williams. This event supports the lifesaving research of David B. Agus, M.D. at USC’s Center for Applied Molecular Medicine.
Get the Story from the Red Carpet Report Team, follow us on Twitter and Facebook at:
www.facebook.com/RedCarpetReportTV
www.youtube.com/MingleMediaTVNetwork
ABOUT THE USC CENTER FOR APPLIED MOLECULAR MEDICINE
The principal goal of the USC Center for Applied Molecular Medicine is the development of novel treatment strategies for cancer. The Center was implemented to enable a convergence of multiple disciplines to work on treatment and the care of patients with cancer. The program includes the clinical care of patients with cancer at the USC Westside Cancer Center in Beverly Hills and has team members with expertise spanning cancer biology, biochemistry, molecular biology, bioinformatics, computer science, electrical engineering, bioorganic chemistry, physics and applied mathematics. For information, visit camm.usc.edu/.
For more of Mingle Media TV’s Red Carpet Report coverage, please visit our website and follow us on Twitter and Facebook here:
www.facebook.com/minglemediatvnetwork
www.flickr.com/MingleMediaTVNetwork
Follow our host Paige Sullivan on Twitter at twitter.com/PaigeSull
The Northwest Association for Biomedical Research was excited to share with teachers our bioinformatics program, New Frontiers in Bioinformatics and Computational Biology funded by the National Science Foundation. The two-day workshop began in the Seattle research center of Novo Nordisk A/S and ended at Shoreline Community College, which features a Biotechnology Lab Specialist Program.
My article is on p.36 of the Computer History Museum Core.
Moore's Law is both a prediction and an abstraction
The popular perception of Moore’s Law is that computer chips are compounding in their complexity at near constant per unit cost. This is one of the many abstractions of Moore’s Law, and it relates to the compounding of transistor density in two dimensions. Others relate to speed (the signals have less distance to travel) or computational power (speed x density).
Unless you work for a chip company and focus on fab-yield optimization, you do not care about transistor counts. Integrated circuit customers do not buy transistors. Consumers of technology purchase computational speed and data storage density. When recast in these terms, Moore’s Law is no longer a transistor-centric metric, and this abstraction allows for longer-term analysis.
What Moore observed in the belly of the early IC industry was a derivative metric, a refracted signal, from a longer-term trend, a trend that begs various philosophical questions and predicts mind-bending futures.
Humanity’s compounding capacity to compute.
Ray Kurzweil’s abstraction of Moore’s Law shows computational power on a logarithmic scale, and finds a double exponential curve that holds over 110 years! A straight line would represent a geometrically compounding curve of progress.
[see graph in first comment below]
Through five paradigm shifts – such as electro-mechanical calculators and vacuum tube computers – the computational power that $1000 buys has doubled every two years. For the past 30 years, it has been doubling every year.
Each dot is the frontier of computational price performance of the day. One machine was used in the 1890 Census; one cracked the Nazi Enigma cipher in World War II; one predicted Eisenhower’s win in the 1956 Presidential election. Many of them can be seen in the Computer History Museum.
Each dot represents a human drama. Prior to Moore’s first paper in 1965, none of them even knew they were on a predictive curve. Each dot represents an attempt to build the best computer with the tools of the day. Of course, we use these computers to make better design software and manufacturing control algorithms. And so the progress continues.
Notice that the pace of innovation is exogenous to the economy. The Great Depression and the World Wars and various recessions do not introduce a meaningful change in the long-term trajectory of Moore’s Law. Certainly, the adoption rates, revenue, profits and economic fates of the computer companies behind the various dots on the graph may go though wild oscillations, but the long-term trend emerges nevertheless.
Any one technology, such as the CMOS transistor, follows an elongated S-shaped curve of slow progress during initial development, upward progress during a rapid adoption phase, and then slower growth from market saturation over time. But a more generalized capability, such as computation, storage, or bandwidth, tends to follow a pure exponential – bridging across a variety of technologies and their cascade of S-curves.
In the modern era of accelerating change in the tech industry, it is hard to find even five-year trends with any predictive value, let alone trends that span the centuries. I would go further and assert that this is the most important graph ever conceived.
Why is this the most important graph in human history?
A large and growing set of industries depends on continued exponential cost declines in computational power and storage density. Moore’s Law drives electronics, communications and computers and has become a primary driver in drug discovery, biotech and bioinformatics, medical imaging and diagnostics. As Moore’s Law crosses critical thresholds, a formerly lab science of trial and error experimentation becomes a simulation science, and the pace of progress accelerates dramatically, creating opportunities for new entrants in new industries. Boeing used to rely on the wind tunnels to test novel aircraft design performance. Ever since CFD modeling became powerful enough, design moves to the rapid pace of iterative simulations, and the nearby wind tunnels of NASA Ames lie fallow. The engineer can iterate at a rapid rate while simply sitting at their desk.
Every industry on our planet is going to become an information business. Consider agriculture. If you ask a farmer in 20 years’ time about how they compete, it will depend on how they use information, from satellite imagery driving robotic field optimization to the code in their seeds. It will have nothing to do with workmanship or labor. That will eventually percolate through every industry as IT innervates the economy.
Non-linear shifts in the marketplace are also essential for entrepreneurship and meaningful change. Technology’s exponential pace of progress has been the primary juggernaut of perpetual market disruption, spawning wave after wave of opportunities for new companies. Without disruption, entrepreneurs would not exist.
Moore’s Law is not just exogenous to the economy; it is why we have economic growth and an accelerating pace of progress. At Future Ventures, we see that in the growing diversity and global impact of the entrepreneurial ideas that we see each year. The industries impacted by the current wave of tech entrepreneurs are more diverse, and an order of magnitude larger than those of the 90’s — from automobiles and aerospace to energy and chemicals.
At the cutting edge of computational capture is biology; we are actively reengineering the information systems of biology and creating synthetic microbes whose DNA is manufactured from bare computer code and an organic chemistry printer. But what to build? So far, we largely copy large tracts of code from nature. But the question spans across all the complex systems that we might wish to build, from cities to designer microbes, to computer intelligence.
Reengineering engineering
As these systems transcend human comprehension, we will shift from traditional engineering to evolutionary algorithms and iterative learning algorithms like deep learning and machine learning. As we design for evolvability, the locus of learning shifts from the artifacts themselves to the process that created them. There is no mathematical shortcut for the decomposition of a neural network or genetic program, no way to "reverse evolve" with the ease that we can reverse engineer the artifacts of purposeful design. The beauty of compounding iterative algorithms (evolution, fractals, organic growth, art) derives from their irreducibility. And it empowers us to design complex systems that exceed human understanding.
Why does progress perpetually accelerate?
All new technologies are combinations of technologies that already exist. Innovation does not occur in a vacuum; it is a combination of ideas from before. In any academic field, the advances today are built on a large edifice of history. . This is why major innovations tend to be 'ripe' and tend to be discovered at the nearly the same time by multiple people. The compounding of ideas is the foundation of progress, something that was not so evident to the casual observer before the age of science. Science tuned the process parameters for innovation, and became the best method for a culture to learn.
From this conceptual base, come the origin of economic growth and accelerating technological change, as the combinatorial explosion of possible idea pairings grows exponentially as new ideas come into the mix (on the order of 2^n of possible groupings per Reed’s Law). It explains the innovative power of urbanization and networked globalization. And it explains why interdisciplinary ideas are so powerfully disruptive; it is like the differential immunity of epidemiology, whereby islands of cognitive isolation (e.g., academic disciplines) are vulnerable to disruptive memes hopping across, much like South America was to smallpox from Cortés and the Conquistadors. If disruption is what you seek, cognitive island-hopping is good place to start, mining the interstices between academic disciplines.
It is the combinatorial explosion of possible innovation-pairings that creates economic growth, and it’s about to go into overdrive. In recent years, we have begun to see the global innovation effects of a new factor: the internet. People can exchange ideas like never before Long ago, people were not communicating across continents; ideas were partitioned, and so the success of nations and regions pivoted on their own innovations. Richard Dawkins states that in biology it is genes which really matter, and we as people are just vessels for the conveyance of genes. It’s the same with ideas or “memes”. We are the vessels that hold and communicate ideas, and now that pool of ideas percolates on a global basis more rapidly than ever before.
In the next 6 years, three billion minds will come online for the first time to join this global conversation (via inexpensive smart phones in the developing world). This rapid influx of three billion people to the global economy is unprecedented in human history, and so to, will the pace of idea-pairings and progress.
We live in interesting times, at the cusp of the frontiers of the unknown and breathtaking advances. But, it should always feel that way, engendering a perpetual sense of future shock.
The Northwest Association for Biomedical Research was excited to share with teachers our bioinformatics program, New Frontiers in Bioinformatics and Computational Biology funded by the National Science Foundation. The two-day workshop began in the Seattle research center of Novo Nordisk A/S and ended at Shoreline Community College, which features a Biotechnology Lab Specialist Program.
Hannah Freund (they/them), Ph.D. student in the genetics, genomic, and bioinformatics program, rallies the crowd of striking academic workers.
University of California Riverside (UCR) students apart of the Union of Academic Workers (UAW) began a strike across all UC campuses on Nov 14. Strikers are bargaining with the UC for things like higher wages, transportation subsidies, childcare subsidies. The strike could last at least a week while the parties come back to the table.
Photo by Stephen Day, Viewpoints.
World leader, scientist, medical scientist, virologist, pharmacist, Professor Fangruida (F.D Smith) on the world epidemic and the nemesis and prevention of new coronaviruses and mutant viruses (Jacques Lucy) 2021v1.5)
_-----------------------------------------
The Nemesis and Killer of New Coronavirus and Mutated Viruses-Joint Development of Vaccines and Drugs (Fangruida) July 2021
*The particularity of new coronaviruses and mutant viruses*The broad spectrum, high efficiency, redundancy, and safety of the new coronavirus vaccine design and development , Redundancy and safety
*New coronavirus drug chemical structure modification*Computer-aided design and drug screening. *"Antiviral biological missile", "New Coronavirus Anti-epidemic Tablets", "Composite Antiviral Oral Liquid", "New Coronavirus Long-acting Oral Tablets", "New Coronavirus Inhibitors" (injection)
——————————————————————————
(World leader, scientist, medical scientist, biologist, virologist, pharmacist, FD Smith) "The Nemesis and Killer of New Coronavirus and Mutated Viruses-The Joint Development of Vaccines and Drugs" is an important scientific research document. Now it has been revised and re-published by the original author several times. The compilation is published and published according to the original manuscript to meet the needs of readers and netizens all over the world. At the same time, it is also of great benefit to the vast number of medical clinical drug researchers and various experts and scholars. We hope that it will be corrected in the reprint.------Compiled by Jacques Lucy in Geneva, August 2021
-------------------------------------------------- ---------------------
According to Worldometer's real-time statistics, as of about 6:30 on July 23, there were a total of 193,323,815 confirmed cases of new coronary pneumonia worldwide, and a total of 4,150,213 deaths. There were 570,902 new confirmed cases and 8,766 new deaths worldwide in a single day. Data shows that the United States, Brazil, the United Kingdom, India, and Indonesia are the five countries with the largest number of new confirmed cases, and Indonesia, Brazil, Russia, South Africa, and India are the five countries with the largest number of new deaths.
The new coronavirus and delta mutant strains have been particularly serious in the recent past. Many countries and places have revived, and the number of cases has not decreased, but has increased.
, It is worthy of vigilance. Although many countries have strengthened vaccine prevention and control and other prevention and control measures, there are still many shortcomings and deficiencies in virus suppression and prevention. The new coronavirus and various mutant strains have a certain degree of antagonism to traditional drugs and most vaccines. Although most vaccines have great anti-epidemic properties and have important and irreplaceable effects and protection for prevention and treatment, it is impossible to completely prevent the spread and infection of viruses. The spread of the new crown virus pneumonia has been delayed for nearly two years. There are hundreds of millions of people infected worldwide, millions of deaths, and the time is long, the spread is widespread, and billions of people around the world are among them. The harm of the virus is quite terrible. This is well known. of. More urgent
What is more serious is that the virus and mutant strains have not completely retreated, especially many people are still infected and infected after being injected with various vaccines. The effectiveness of the vaccine and the resistance of the mutant virus are worthy of medical scientists, virologists, pharmacologists Zoologists and others seriously think and analyze. The current epidemic situation in European and American countries, China, Brazil, India, the United States, Russia and other countries has greatly improved from last year. However, relevant figures show that the global epidemic situation has not completely improved, and some countries and regions are still very serious. In particular, after extensive use of various vaccines, cases still occur, and in some places they are still very serious, which deserves a high degree of vigilance. Prevention and control measures are very important. In addition, vaccines and various anti-epidemic drugs are the first and necessary choices, and other methods are irreplaceable. It is particularly important to develop and develop comprehensive drugs, antiviral drugs, immune drugs, and genetic drugs. Research experiments on new coronaviruses and mutant viruses require more rigorous and in-depth data analysis, pathological pathogenic tissues, cell genes, molecular chemistry, quantum chemistry, etc., as well as vaccine molecular chemistry, quantum physics, quantum biology, cytological histology, medicinal chemistry, and drugs And the vaccine’s symptomatic, effectiveness, safety, long-term effectiveness, etc., of course, including tens of thousands of clinical cases and deaths and other first-hand information and evidence. The task of RNA (ribonucleic acid) in the human body is to use the information of our genetic material DNA to produce protein. It accomplishes this task in the ribosome, the protein-producing area of the cell. The ribosome is the place where protein biosynthesis occurs.
Medicine takes advantage of this: In vaccination, artificially produced mRNA provides ribosomes with instructions for constructing pathogen antigens to fight against—for example, the spike protein of coronavirus.
Traditional live vaccines or inactivated vaccines contain antigens that cause the immune system to react. The mRNA vaccine is produced in the cell
(1) The specificity of new coronaviruses and mutant viruses, etc., virology and quantum chemistry of mutant viruses, quantum physics, quantum microbiology
(2) New crown vaccine design, molecular biology and chemical structure, etc.
(3) The generality and particularity of the development of new coronavirus drugs
(4) Various drug design for new coronavirus pneumonia, medicinal chemistry, pharmacology, etc., cells, proteins, DNA, enzyme chemistry, pharmaceutical quantum chemistry, pharmaceutical quantum physics, human biochemistry, human biophysics, etc.
(5) The evolution and mutation characteristics of the new coronavirus and various mutant viruses, the long-term nature, repeatability, drug resistance, and epidemic resistance of the virus, etc.
(6) New coronavirus pneumonia and the infectious transmission of various new coronaviruses and their particularities
(7) The invisible transmission of new coronavirus pneumonia and various mutant viruses in humans or animals, and the mutual symbiosis of cross infection of various bacteria and viruses are also one of the very serious causes of serious harm to new coronaviruses and mutant viruses. Virology, pathology, etiology, gene sequencing, gene mapping, and a large number of analytical studies have shown that there are many cases in China, the United States, India, Russia, Brazil, and other countries.
(8) For the symptomatic prevention and treatment of the new coronavirus, the combination of various vaccines and various antiviral drugs is critical.
(9) According to the current epidemic situation and research judgments, the epidemic situation may improve in the next period of time and 2021-2022, and we are optimistic about its success. However, completely worry-free, it is still too early to win easily. It is not just relying on vaccination. Wearing masks to close the city and other prevention and control measures and methods can sit back and relax, and you can win a big victory. Because all kinds of research and exploration still require a lot of time and various experimental studies. It is not a day's work. A simple taste is very dangerous and harmful. The power and migratory explosiveness of viruses sometimes far exceed human thinking and perception. In the future, next year, or in the future, whether viruses and various evolutionary mutation viruses will re-attack, we still need to study, analyze, prevent and control, rather than being complacent, thinking that the vaccine can win a big victory is inevitably naive and ridiculous. Vaccine protection is very important, but it must not be taken carelessly. The mutation of the new crown virus is very rampant, and the cross-infection of recessive and virulent bacteria makes epidemic prevention and anti-epidemic very complicated.
(10) New crown virus pneumonia and the virus's stubbornness, strength, migration, susceptibility, multi-infectiousness, and occult. The effectiveness of various vaccines and the particularity of virus mutations The long-term hidden dangers and repeated recurrences of the new coronavirus
(11) The formation mechanism and invisible transmission of invisible viruses, asymptomatic infections and asymptomatic infections, asymptomatic transmission routes, asymptomatic infections, pathological pathogens. The spread and infection of viruses and mutated viruses, the blind spots and blind spots of virus vaccines, viral quantum chemistry and
The chemical and physical corresponding reactions at the meeting points of highly effective vaccine drugs, etc. The variability of mutated viruses is very complicated, and vaccination cannot completely prevent the spread of infection.
(12) New crown virus pneumonia and various respiratory infectious diseases are susceptible to infections in animals and humans, and are frequently recurring. This is one of the frequently-occurring and difficult diseases of common infectious diseases. Even with various vaccines and various antiviral immune drugs, it is difficult to completely prevent the occurrence and spread of viral pneumonia. Therefore, epidemic prevention and anti-epidemic is a major issue facing human society, and no country should take it lightly. The various costs that humans pay on this issue are very expensive, such as Ebola virus, influenza A virus,
Hepatitis virus,
Marburg virus
Sars coronavirus, plague, anthracnose, cholera
and many more. The B.1.1.7 mutant virus that was first discovered in the UK was renamed Alpha mutant virus; the B.1.351 that was first discovered in South Africa was renamed Beta mutant virus; the P.1 that was first discovered in Brazil was renamed Gamma mutant virus; the mutation was first discovered in India There are two branches of the virus. B.1.617.2, which was listed as "mutated virus of concern", was renamed Delta mutant virus, and B.1.617.1 of "mutated virus to be observed" was renamed Kappa mutant virus.
However, experts in many countries believe that the current vaccination is still effective, at least it can prevent severe illness and reduce deaths.
Delta mutant strain
According to the degree of risk, the WHO divides the new crown variant strains into two categories: worrying variant strains (VOC, variant of concern) and noteworthy variant strains (VOI, variant of interest). The former has caused many cases and a wide range of cases worldwide, and data confirms its transmission ability, strong toxicity, high power, complex migration, and high insidious transmission of infection. Resistance to vaccines may lead to the effectiveness of vaccines and clinical treatments. Decrease; the latter has confirmed cases of community transmission worldwide, or has been found in multiple countries, but has not yet formed a large-scale infection. Need to be very vigilant. Various cases and deaths in many countries in the world are related to this. In some countries, the epidemic situation is repeated, and it is also caused by various reasons and viruses, of course, including new cases and so on.
At present, VOC is the mutant strain that has the greatest impact on the epidemic and the greatest threat to the world, including: Alpha, Beta, Gamma and Delta. , Will the change of the spur protein in the VOC affect the immune protection effect of the existing vaccine, or whether it will affect the sensitivity of the VOC to the existing vaccine? For this problem, it is necessary to directly test neutralizing antibodies, such as those that can prevent the protection of infection. Antibodies recognize specific protein sequences on viral particles, especially those spike protein sequences used in mRNA vaccines.
(13) Countries around the world, especially countries and regions with more severe epidemics, have a large number of clinical cases, severe cases, and deaths, especially including many young and middle-aged patients, including those who have been vaccinated. The epidemic is more complicated and serious. Injecting various vaccines, taking strict control measures such as closing the city and wearing masks are very important and the effect is very obvious. However, the new coronavirus and mutant viruses are so repeated, their pathological pathogen research will also be very complicated and difficult. After the large-scale use of the vaccine, many people are still infected. In addition to the lack of prevention and control measures, it is very important that the viability of the new coronavirus and various mutant viruses is very important. It can escape the inactivation of the vaccine. It is very resistant to stubbornness. Therefore, the recurrence of new coronavirus pneumonia is very dangerous. What is more noteworthy is that medical scientists, virologists, pharmacists, biologists, zoologists and clinicians should seriously consider the correspondence between virus specificity and vaccine drugs, and the coupling of commonality and specificity. Only in this way can we find targets. Track and kill viruses. Only in this sense can the new crown virus produce a nemesis, put an end to and eradicate the new crown virus pneumonia. Of course, this is not a temporary battle, but a certain amount of time and process to achieve the goal in the end.
(14) The development and evolution of the natural universe and earth species, as well as life species. With the continuous evolution of human cell genes, microbes and bacterial viruses are constantly mutated and inherited. The new world will inevitably produce a variety of new pathogens.
And viruses. For example, neurological genetic disease, digestive system disease, respiratory system disease, blood system disease, cardiopulmonary system disease, etc., new diseases will continue to emerge as humans develop and evolve. Human migration to space, space diseases, space psychological diseases, space cell diseases, space genetic diseases, etc. Therefore, for the new coronavirus and mutated viruses, we must have sufficient knowledge and response, and do not think that it will be completely wiped out.
, And is not a scientific attitude. Viruses and humans mutually reinforce each other, and viruses and animals and plants mutually reinforce each other. This is the iron law of the natural universe. Human beings can only adapt to natural history, but cannot deliberately modify natural history.
Active immune products made from specific bacteria, viruses, rickettsiae, spirochetes, mycoplasma and other microorganisms and parasites are collectively called vaccines. Vaccination of animals can make the animal body have specific immunity. The principle of vaccines is to artificially attenuate, inactivate, and genetically attenuate pathogenic microorganisms (such as bacteria, viruses, rickettsia, etc.) and their metabolites. Purification and preparation methods, made into immune preparations for the prevention of infectious diseases. In terms of ingredients, the vaccine retains the antigenic properties and other characteristics of the pathogen, which can stimulate the body's immune response and produce protective antibodies. But it has no pathogenicity and does not cause harm to the body. When the body is exposed to this pathogen again, the immune system will produce more antibodies according to the previous memory to prevent the pathogen from invading or to fight against the damage to the body. (1) Inactivated vaccines: select pathogenic microorganisms with strong immunogenicity, culture them, inactivate them by physical or chemical methods, and then purify and prepare them. The virus species used in inactivated vaccines are generally virulent strains, but the use of attenuated attenuated strains also has good immunogenicity, such as the inactivated polio vaccine produced by the Sabin attenuated strain. The inactivated vaccine has lost its infectivity to the body, but still maintains its immunogenicity, which can stimulate the body to produce corresponding immunity and resist the infection of wild strains. Inactivated vaccines have a good immune effect. They can generally be stored for more than one year at 2~8°C without the risk of reversion of virulence; however, the inactivated vaccines cannot grow and reproduce after entering the human body. They stimulate the human body for a short time and must be strong and long-lasting. In general, adjuvants are required for immunity, and multiple injections in large doses are required, and the local immune protection of natural infection is lacking. Including bacteria, viruses, rickettsiae and toxoid preparations.
(2) Live attenuated vaccine: It is a vaccine made by using artificial targeted mutation methods or by screening live microorganisms with highly weakened or basically non-toxic virulence from the natural world. After inoculation, the live attenuated vaccine has a certain ability to grow and reproduce in the body, which can cause the body to have a reaction similar to a recessive infection or a mild infection, and it is widely used.
(3) Subunit vaccine: Among the multiple specific antigenic determinants carried by macromolecular antigens, only a small number of antigenic sites play an important role in the protective immune response. Separate natural proteins through chemical decomposition or controlled proteolysis, and extract bacteria and virusesVaccines made from fragments with immunological activity are screened out of the special protein structure of, called subunit vaccines. Subunit vaccines have only a few major surface proteins, so they can eliminate antibodies induced by many unrelated antigens, thereby reducing the side effects of the vaccine and related diseases and other side effects caused by the vaccine. (4) Genetically engineered vaccine: It uses DNA recombination biotechnology to direct the natural or synthetic genetic material in the pathogen coat protein that can induce the body's immune response into bacteria, yeast or mammalian cells to make it fully expressed. A vaccine prepared after purification. The application of genetic engineering technology can produce subunit vaccines that do not contain infectious substances, stable attenuated vaccines with live viruses as carriers, and multivalent vaccines that can prevent multiple diseases. This is the second-generation vaccine following the first-generation traditional vaccine. It has the advantages of safety, effectiveness, long-term immune response, and easy realization of combined immunization. It has certain advantages and effects.
New coronavirus drug development, drug targets and chemical modification.
Ligand-based drug design (or indirect drug design planning) relies on the knowledge of other molecules that bind to the target biological target. These other molecules can be used to derive pharmacophore models and structural modalities, which define the minimum necessary structural features that the molecule must have in order to bind to the target. In other words, a model of a biological target can be established based on the knowledge of the binding target, and the model can be used to design new molecular entities and other parts that interact with the target. Among them, the quantitative structure-activity relationship (QSAR) is included, in which the correlation between the calculated properties of the molecule and its experimentally determined biological activity can be derived. These QSAR relationships can be used to predict the activity of new analogs. The structure-activity relationship is very complicated.
Based on structure
Structure-based drug design relies on knowledge of the three-dimensional structure of biological targets obtained by methods such as X-ray crystallography or NMR spectroscopy and quantum chemistry. If the experimental structure of the target is not available, it is possible to create a homology model of the target and other standard models that can be compared based on the experimental structure of the relevant protein. Using the structure of biological targets, interactive graphics and medical chemists’ intuitive design can be used to predict drug candidates with high affinity and selective binding to the target. Various automatic calculation programs can also be used to suggest new drug candidates.
The current structure-based drug design methods can be roughly divided into three categories. The 3D method is to search a large database of small molecule 3D structures to find new ligands for a given receptor, in order to use a rapid approximate docking procedure to find those suitable for the receptor binding pocket. This method is called virtual screening. The second category is the de novo design of new ligands. In this method, by gradually assembling small fragments, a ligand molecule is established within the constraints of the binding pocket. These fragments can be single atoms or molecular fragments. The main advantage of this method is that it can propose novel structures that are not found in any database. The third method is to optimize the known ligand acquisition by evaluating the proposed analogs in the binding cavity.
Bind site ID
Binding site recognition is a step in structure-based design. If the structure of the target or a sufficiently similar homologue is determined in the presence of the bound ligand, the ligand should be observable in that structure, in which case the location of the binding site is small. However, there may not be an allosteric binding site of interest. In addition, only apo protein structures may be available, and it is not easy to reliably identify unoccupied sites that have the potential to bind ligands with high affinity. In short, the recognition of binding sites usually depends on the recognition of pits. The protein on the protein surface can hold molecules the size of drugs, etc. These molecules also have appropriate "hot spots" that drive ligand binding, hydrophobic surfaces, hydrogen bonding sites, and so on.
Drug design is a creative process of finding new drugs based on the knowledge of biological targets. The most common type of drug is small organic molecules that activate or inhibit the function of biomolecules, thereby producing therapeutic benefits for patients. In the most important sense, drug design involves the design of molecules with complementary shapes and charges that bind to their interacting biomolecular targets, and therefore will bind to them. Drug design often but does not necessarily rely on computer modeling techniques. A more accurate term is ligand design. Although the design technology for predicting binding affinity is quite successful, there are many other characteristics, such as bioavailability, metabolic half-life, side effects, etc., which must be optimized first before the ligand can become safe and effective. drug. These other features are usually difficult to predict and realize through reasonable design techniques. However, due to the high turnover rate, especially in the clinical stage of drug development, in the early stage of the drug design process, more attention is paid to the selection of drug candidates. The physical and chemical properties of these drug candidates are expected to be reduced during the development process. Complications are therefore more likely to lead to the approval of the marketed drug. In addition, in early drug discovery, in vitro experiments with computational methods are increasingly used to select compounds with more favorable ADME (absorption, distribution, metabolism, and excretion) and toxicological characteristics. A more accurate term is ligand design. Although the design technique for predicting binding affinity is quite successful, there are many other characteristics, such as bioavailability, metabolic half-life, side effects, iatrogenic effects, etc., which must be optimized first, and then the ligand To become safe and effective.
For drug targets, two aspects should be considered when selecting drug targets:
1. The effectiveness of the target, that is, the target is indeed related to the disease, and the symptoms of the disease can be effectively improved by regulating the physiological activity of the target.
2. The side effects of the target. If the regulation of the physiological activity of the target inevitably produces serious side effects, it is inappropriate to select it as the target of drug action or lose its important biological activity. The reference frame of the target should be expanded in multiple dimensions to have a big choice.
3. Search for biomolecular clues related to diseases: use genomics, proteomics and biochip technology to obtain biomolecular information related to diseases, and perform bioinformatics analysis to obtain clue information.
4. Perform functional research on related biomolecules to determine the target of candidate drugs. Multiple targets or individual targets.
5. Candidate drug targets, design small molecule compounds, and conduct pharmacological research at the molecular, cellular and overall animal levels.
Covalent bonding type
The covalent bonding type is an irreversible form of bonding, similar to the organic synthesis reaction that occurs. Covalent bonding types mostly occur in the mechanism of action of chemotherapeutic drugs. For example, alkylating agent anti-tumor drugs produce covalent bonding bonds to guanine bases in DNA, resulting in cytotoxic activity.
. Verify the effectiveness of the target.
Based on the targets that interact with drugs, that is, receptors in a broad sense, such as enzymes, receptors, ion channels, membranes, antigens, viruses, nucleic acids, polysaccharides, proteins, enzymes, etc., find and design reasonable drug molecules. Targets of action and drug screening should focus on multiple points. Drug intermediates and chemical modification. Combining the development of new drugs with the chemical structure modification of traditional drugs makes it easier to find breakthroughs and develop new antiviral drugs. For example, careful selection, modification and modification of existing related drugs that can successfully treat and recover a large number of cases, elimination and screening of invalid drugs from severe death cases, etc., are targeted, rather than screening and capturing needles in a haystack, aimless, with half the effort. Vaccine design should also be multi-pronged and focused. The broad-spectrum, long-term, safety, efficiency and redundancy of the vaccine should all be considered. In this way, it will be more powerful to deal with the mutation and evolution of the virus. Of course, series of vaccines, series of drugs, second-generation vaccines, third-generation vaccines, second-generation drugs, third-generation drugs, etc. can also be developed. Vaccines focus on epidemic prevention, and medicines focus on medical treatment. The two are very different; however, the two complement each other and complement each other. Therefore, in response to large-scale epidemics of infectious diseases, vaccines and various drugs are the nemesis and killers of viral diseases. Of course, it also includes other methods and measures, so I won't repeat them here.
Mainly through the comprehensive and accurate understanding of the structure of the drug and the receptor at the molecular level and even the electronic level, structure-based drug design and the understanding of the structure, function, and drug action mode of the target and the mechanism of physiological activity Mechanism-based drug design.
Compared with the traditional extensive pharmacological screening and lead compound optimization, it has obvious advantages.
Viral RNA replicase, also known as RNA-dependent RNA polymerase (RdRp) is responsible for the replication and transcription of RNA virus genome, and plays a very important role in the process of virus self-replication in host cells, and It also has a major impact on the mutation of the virus, it will change and accelerate the replication and recombination. Because RdRp from different viruses has a highly conserved core structure, the virus replicase is an important antiviral drug target and there are other selection sites, rather than a single isolated target target such as the new coronavirus As with various mutant viruses, inhibitors developed for viral replicase are expected to become a broad-spectrum antiviral drug. The currently well-known anti-coronavirus drug remdesivir (remdesivir) is a drug for viral replicase.
New antiviral therapies are gradually emerging. In addition to traditional polymerase and protease inhibitors, nucleic acid drugs, cell entry inhibitors, nucleocapsid inhibitors, and drugs targeting host cells are also increasingly appearing in the research and development of major pharmaceutical companies. The treatment of mutated viruses is becoming increasingly urgent. The development of drugs for the new coronavirus pneumonia is very important. It is not only for the current global new coronavirus epidemic, but more importantly, it is of great significance to face the severe pneumonia-respiratory infectious disease that poses a huge threat to humans.
There are many vaccines and related drugs developed for the new coronavirus pneumonia, and countries are vying for a while, mainly including the following:
Identification test, appearance, difference in loading, moisture, pH value, osmolality, polysaccharide content, free polysaccharide content, potency test, sterility test, pyrogen test, bacterial endotoxin test, abnormal toxicity test.
Among them: such as sterility inspection, pyrogen inspection, bacterial endotoxin, and abnormal toxicity inspection are indicators closely related to safety.
Polysaccharide content, free polysaccharide content, and efficacy test are indicators closely related to vaccine effectiveness.
Usually, a vaccine will go through a long research and development process of at least 8 years or even more than 20 years from research and development to marketing. The outbreak of the new crown epidemic requires no delay, and the design and development of vaccines is speeding up. It is not surprising in this special period. Of course, it is understandable that vaccine design, development and testing can be accelerated, shortened the cycle, and reduced some procedures. However, science needs to be rigorous and rigorous to achieve great results. The safety and effectiveness of vaccines are of the utmost importance. There must not be a single error. Otherwise, it will be counterproductive and need to be continuously improved and perfected.
Pre-clinical research: The screening of strains and cells is the basic guarantee to ensure the safety, effectiveness, and continuous supply of vaccines. Taking virus vaccines as an example, the laboratory stage needs to carry out strain screening, necessary strain attenuation, strain adaptation to the cultured cell matrix and stability studies in the process of passaging, and explore the stability of process quality, establish animal models, etc. . Choose mice, guinea pigs, rabbits or monkeys for animal experiments according to each vaccine situation. Pre-clinical research generally takes 5-10 years or longer on the premise that the process is controllable, the quality is stable, and it is safe and effective. In order to be safe and effective, a certain redundant design is also needed, so that the safety and effectiveness of the vaccine can be importantly guaranteed.
These include the establishment of vaccine strain/cell seed bank, production process research, quality research, stability research, animal safety evaluation and effectiveness evaluation, and clinical trial programs, etc.
The ARS-CoV-2 genome contains at least 10 ORFs. ORF1ab is converted into a polyprotein and processed into 16 non-structural proteins (NSP). These NSPs have a variety of functional biological activities, physical and chemical reactions, such as genome replication, induction of host mRNA cleavage, membrane rearrangement, autophagosome production, NSP polyprotein cleavage, capping, tailing, methylation, RNA double-stranded Uncoiling, etc., and others, play an important role in the virus life cycle. In addition, SARS-CoV-2 contains 4 structural proteins, namely spike (S), nucleocapsid (N), envelope (E) and membrane (M), all of which are encoded by the 3'end of the viral genome. Among the four structural proteins, S protein is a large multifunctional transmembrane protein that plays an important role in the process of virus adsorption, fusion, and injection into host cells, and requires in-depth observation and research.
1S protein is composed of S1 and S2 subunits, and each subunit can be further divided into different functional domains. The S1 subunit has 2 domains: NTD and RBD, and RBD contains conservative RBM. The S2 subunit has 3 structural domains: FP, HR1 and HR2. The S1 subunit is arranged at the top of the S2 subunit to form an immunodominant S protein.
The virus uses the host transmembrane protease Serine 2 (TMPRSS2) and the endosomal cysteine protease CatB/L to enter the cell. TMPRSS2 is responsible for the cleavage of the S protein to expose the FP region of the S2 subunit, which is responsible for initiating endosome-mediated host cell entry into it. It shows that TMPRSS2 is a host factor necessary for virus entry. Therefore, the use of drugs that inhibit this protease can achieve the purpose of treatment.
mRNA-1273
The mRNA encoding the full length of SARS-CoV-2, and the pre-spike protein fusion is encapsulated into lipid nanoparticles to form mRNA-1273 vaccine. It can induce a high level of S protein specific antiviral response. It can also consist of inactivated antigens or subunit antigens. The vaccine was quickly approved by the FDA and has entered phase II clinical trials. The company has announced the antibody data of 8 subjects who received different immunization doses. The 25ug dose group achieved an effect similar to the antibody level during the recovery period. The 100ug dose group exceeded the antibody level during the recovery period. In the 25ug and 100ug dose groups, the vaccine was basically safe and tolerable, while the 250ug dose group had 3 levels of systemic symptoms.
Viral vector vaccines can provide long-term high-level expression of antigen proteins, induce CTLs, and ultimately eliminate viral infections.
1, Ad5-nCov
A vaccine of SARS-CoV-2 recombinant spike protein expressed by recombinant, replication-deficient type 5 adenovirus (Ad5) vector. Load the optimized full-length S protein gene together with the plasminogen activation signal peptide gene into the E1 and E3 deleted Ad5 vectors. The vaccine is constructed by the Admax system derived from Microbix Biosystem. In phase I clinical trials, RBD (S1 subunit receptor binding domain) and S protein neutralizing antibody increased by 4 times 14 days after immunization, reaching a peak on 28 days. CD4+T and CD8+T cells reached a peak 14 days after immunization. The existing Ad5 immune resistance partially limits the response of antibodies and T cells. This study will be further conducted in the 18-60 age group, receiving 1/3 of the study dose, and follow-up for 3-6 months after immunization.
DNA vaccine
The introduction of antigen-encoding DNA and adjuvants as vaccines is the most innovative vaccine method. The transfected cells stably express the transgenic protein, similar to live viruses. The antigen will be endocytosed by immature DC, and finally provide antigen to CD4 + T, CD8 + T cells (by MHC differentiation) To induce humoral and cellular immunity. Some specificities of the virus and the new coronavirus mutant are different from general vaccines and other vaccines. Therefore, it is worth noting the gene expression of the vaccine. Otherwise, the effectiveness and efficiency of the vaccine will be questioned.
Live attenuated vaccine
DelNS1-SARS-CoV2-RBD
Basic influenza vaccine, delete NS1 gene. Express SARS-CoV-2 RBD domain. Cultured in CEF and MDCK (canine kidney cells) cells. It is more immunogenic than wild-type influenza virus and can be administered by nasal spray.
The viral genome is susceptible to mutation, antigen transfer and drift can occur, and spread among the population. Mutations can vary depending on the environmental conditions and population density of the geographic area. After screening and comparing 7,500 samples of infected patients, scientists found 198 mutations, indicating the evolutionary mutation of the virus in the human host. These mutations may form different virus subtypes, which means that even after vaccine immunization, viral infections may occur. A certain amount of increment and strengthening is needed here.
Inactivated vaccines, adenovirus vector vaccines, recombinant protein vaccines, nucleic acid vaccines, attenuated influenza virus vector vaccines, etc. According to relevant information, there are dozens of new coronavirus vaccines in the world, and more varieties are being developed and upgraded. Including the United States, Britain, China, Russia, India and other countries, there are more R&D and production units.
AZ vaccine
Modena vaccine
Lianya Vaccine
High-end vaccine
Pfizer vaccine
Pfizer-BioNTech
A large study found that the vaccine developed by Pfizer and German biotechnology company BioNTech is 95% effective in preventing COVID-19.
The vaccine is divided into two doses, which are injected every three weeks.
This vaccine uses a molecule called mRNA as its basis. mRNA is a molecular cousin of DNA, which contains instructions to build specific proteins; in this case, the mRNA in the vaccine encodes the coronavirus spike protein, which is attached to the surface of the virus and used to infect human cells. Once the vaccine enters the human body, it will instruct the body's cells to make this protein, and the immune system will learn to recognize and attack it.
Moderna
The vaccine developed by the American biotechnology company Moderna and the National Institute of Allergy and Infectious Diseases (NIAID) is also based on mRNA and is estimated to be 94.5% effective in preventing COVID-19.
Like Pfizer's vaccine, this vaccine is divided into two doses, but injected every four weeks instead of three weeks. Another difference is that the Moderna vaccine can be stored at minus 20 degrees Celsius instead of deep freezing like Pfizer vaccine. At present, the importance of one of the widely used vaccines is self-evident.
Oxford-AstraZeneca
The vaccine developed by the University of Oxford and the pharmaceutical company AstraZeneca is approximately 70% effective in preventing COVID-19-that is, in clinical trials, adjusting the dose seems to improve this effect.
In the population who received two high-dose vaccines (28 days apart), the effectiveness of the vaccine was about 62%; according to early analysis, the effectiveness of the vaccine in those patients who received the half-dose first and then the full-dose Is 90%. However, in clinical trials, participants taking half doses of the drug are wrong, and some scientists question whether these early results are representative.
Sinopharm Group (Beijing Institute of Biological Products, China)
China National Pharmaceutical Group Sinopharm and Beijing Institute of Biological Products have developed a vaccine from inactivated coronavirus (SARS-CoV-2). The inactivated coronavirus is an improved version that cannot be replicated.
Estimates of the effectiveness of vaccines against COVID-19 vary.
Gamaleya Institute
The Gamaleya Institute of the Russian Ministry of Health has developed a coronavirus vaccine candidate called Sputnik V. This vaccine contains two common cold viruses, adenoviruses, which have been modified so that they will not replicate in the human body; the modified virus also contains a gene encoding the coronavirus spike protein.
New crown drugs
There are many small molecule antiviral drug candidates in the clinical research stage around the world. Including traditional drugs in the past and various drugs yet to be developed, antiviral drugs, immune drugs, Gene drugs, compound drugs, etc.
(A) Molnupiravir
Molnupiravir is a prodrug of the nucleoside analog N4-hydroxycytidine (NHC), jointly developed by Merck and Ridgeback Biotherapeutics.
The positive rate of infectious virus isolation and culture in nasopharyngeal swabs was 0% (0/47), while that of patients in the placebo group was 24% (6/25). However, data from the Phase II/III study indicate that the drug has no benefit in preventing death or shortening the length of stay in hospitalized patients.
Therefore, Merck has decided to fully advance the research of 800mg molnupiravir in the treatment of patients with mild to moderate COVID-19.
(B) AT-527
AT-527 is a small molecule inhibitor of viral RNA polymerase, jointly developed by Roche and Atea. Not only can it be used as an oral therapy to treat hospitalized COVID-19 patients, but it also has the potential as a preventive treatment after exposure.
Including 70 high-risk COVID-19 hospitalized patients data, of which 62 patients' data can be used for virological analysis and evaluation. The results of interim virological analysis show that AT-527 can quickly reduce viral load. On day 2, compared with placebo, patients treated with AT-527 had a greater decline in viral load than the baseline level, and the continuous difference in viral load decline was maintained until day 8.
In addition, compared with the control group, the potent antiviral activity of AT-527 was also observed in patients with a baseline median viral load higher than 5.26 log10. When testing by RT-qPCR to assess whether the virus is cleared,
The safety aspect is consistent with previous studies. AT-527 showed good safety and tolerability, and no new safety problems or risks were found. Of course, there is still a considerable distance between experiment and clinical application, and a large amount of experimental data can prove it.
(C) Prokrutamide
Prokalamide is an AR (androgen receptor) antagonist. Activated androgen receptor AR can induce the expression of transmembrane serine protease (TMPRSS2). TMPRSS2 has a shearing effect on the new coronavirus S protein and ACE2, which can promote the binding of viral spike protein (S protein) to ACE, thereby promoting The virus enters the host cell. Therefore, inhibiting the androgen receptor may inhibit the viral infection process, and AR antagonists are expected to become anti-coronavirus drugs.
Positive results were obtained in a randomized, double-blind, placebo-controlled phase III clinical trial. The data shows that Prokalutamide reduces the risk of death in severely ill patients with new coronary disease by 92%, reduces the risk of new ventilator use by 92%, and shortens the length of hospital stay by 9 days. This shows that procrulamide has a certain therapeutic effect for patients with severe new coronary disease, which can significantly reduce the mortality of patients, and at the same time greatly reduce the new mechanical ventilation and shorten the patient's hospital stay.
With the continuous development of COVID-19 on a global scale, in addition to vaccines and prevention and control measures, we need a multi-pronged plan to control this disease. Oral antiviral therapy undoubtedly provides a convenient treatment option.
In addition, there are other drugs under development and experimentation. In dealing with the plague virus, in addition to the strict control of protective measures, it is very important that various efficient and safe vaccines and various drugs (including medical instruments, etc.) are the ultimate nemesis and killer of the virus.
(A) "Antiviral biological missiles" are mainly drugs for new coronaviruses and mutant viruses, which act on respiratory and lung diseases. The drugs use redundant designs to inhibit new coronaviruses and variant viruses.
(B) "New Coronavirus Epidemic Prevention Tablets" mainly use natural purified elements and chemical structure modifications.
(C) "Composite antiviral oral liquid" antiviral intermediate, natural antiviral plant, plus other preparations
(D) "New Coronavirus Long-acting Oral Tablets" Chemical modification of antiviral drugs, multiple targets, etc.
(E) "New Coronavirus Inhibitors" (injections) are mainly made of chemical drug structure modification and other preparations.
The development of these drugs mainly includes: drug target screening, structure-activity relationship, chemical modification, natural purification, etc., which require a lot of work and experimentation.
Humans need to vigorously develop drugs to deal with various viruses. These drugs are very important for the prevention and treatment of viruses and respiratory infectious diseases, influenza, pneumonia, etc.
The history of human development The history of human evolution, like all living species, will always be accompanied by the survival and development of microorganisms. It is not surprising that viruses and infectious diseases are frequent and prone to occur. The key is to prevent and control them before they happen.
This strain was first discovered in India in October 2020 and was initially called a "double mutant" virus by the media. According to the announcement by the Ministry of Health of India at the end of March this year, the "India New Coronavirus Genomics Alliance" composed of 10 laboratories found in samples collected in Maharashtra that this new mutant strain carries E484Q and L452R mutations. , May lead to immune escape and increased infectivity. This mutant strain was named B.1.617 by the WHO and was named with the Greek letter δ (delta) on May 31.
Shahid Jamil, the dean of the Trivedi School of Biological Sciences at Ashoka University in India and a virologist, said in an interview with the Shillong Times of India that this mutant strain called "double mutation" is not accurate enough. B. 1.617 contains a total of 15 mutations, of which 6 occur on the spike protein, of which 3 are more critical: L452R and E484Q mutations occur on the spike protein and the human cell "Angiotensin Converting Enzyme 2 (ACE2)" receptor In the bound region, L452R improves the ability of the virus to invade cells, and E484Q helps to enhance the immune escape of the virus; the third mutation P681R can also make the virus enter the cell more effectively. (Encyclopedia website)
There are currently dozens of antiviral COVID-19 therapies under development. The large drugmakers Merck and Pfizer are the closest to the end, as expected, a pair of oral antiviral COVID-19 therapies are undergoing advanced human clinical trials.
Merck's drug candidate is called monupiravir. It was originally developed as an influenza antiviral drug several years ago. However, preclinical studies have shown that it has a good effect on SARS and MERS coronavirus.
Monupiravir is currently undergoing in-depth large-scale Phase 3 human trials. So far, the data is so promising that the US government recently pre-ordered 1.7 million courses of drugs at a cost of $1.2 billion. If everything goes according to plan, the company hopes that the drug will be authorized by the FDA for emergency use and be on the market before the end of 2021.
Pfizer's large COVID-19 antiviral drug candidate is more unique. Currently known as PF-07321332, this drug is the first oral antiviral drug to enter human clinical trials, specifically targeting SARS-CoV-2.
Variant of Concern WHO Label First Detected in World First Detected in Washington State
B.1.1.7 Alpha United Kingdom, September 2020 January 2021
B.1.351 Beta South Africa, December 2020 February 2021
P.1 Gamma Brazil, April 2020 March 2021
B.1.617.2 Delta India, October 2020 April 2021
Although this particular molecule was developed in 2020 after the emergence of the new coronavirus, a somewhat related drug called PF-00835231 has been in operation for several years, targeting the original SARS virus. However, the new drug candidate PF-07321332 is designed as a simple pill that can be taken under non-hospital conditions in the initial stages of SARS-CoV-2 infection.
"The protease inhibitor binds to a viral enzyme and prevents the virus from replicating in the cell," Pfizer said when explaining the mechanism of its new antiviral drug. "Protease inhibitors have been effective in the treatment of other viral pathogens, such as HIV and hepatitis C virus, whether used alone or in combination with other antiviral drugs. Currently marketed therapeutic drugs for viral proteases are generally not toxic Therefore, such molecules may provide well-tolerated treatments against COVID-19."
Various studies on other types of antiviral drugs are also gaining momentum. For example, the new coronavirus pneumonia "antiviral biological missile", "new coronavirus prevention tablets", "composite antiviral oral liquid", "new coronavirus long-acting oral tablets", "new coronavirus inhibitors" (injections), etc., are worthy of attention. Like all kinds of vaccines, they will play a major role in preventing and fighting epidemics.
In addition, Japanese pharmaceutical company Shionoyoshi Pharmaceutical is currently conducting a phase 1 trial of a protease inhibitor similar to SARS-CoV-2. This is called S-217622, which is another oral antiviral drug, and hopes to provide people with an easy-to-take pill in the early stages of COVID-19. At present, the research and development of vaccines and various new crown drugs is very active and urgent. Time does not wait. With the passage of time, various new crown drugs will appear on the stage one after another, bringing the gospel to the complete victory of mankind.
The COVID-19 pandemic is far from over. The Delta mutant strain has quickly become the most prominent SARS-CoV-2 strain in the world. Although our vaccine is still maintained, it is clear that we need more tools to combat this new type of coronavirus. Delta will certainly not be the last new SARS-CoV-2 variant we encountered. Therefore, it is necessary for all mankind to persevere and fight the epidemic together.
Overcome illness and meet new challenges. The new crown epidemic and various mutated viruses are very important global epidemic prevention and anti-epidemic top priorities, especially for the current period of time. Vaccine injections, research and development of new drugs, strict prevention and control, wear masks, reduce gatherings, strictly control large gatherings, prevent the spread of various viruses Masks, disinfection and sterilization, lockdown of the city, vaccinations, accounting and testing are very important, but this does not mean that humans can completely overcome the virus. In fact, many spreading and new latently transmitted infections are still unsuccessful. There are detections, such as invisible patients, asymptomatic patients, migratory latent patients, new-onset patients, etc. The struggle between humans and the virus is still very difficult and complicated, and long-term efforts and exploration are still needed, especially for medical research on the new coronavirus. The origin of the disease, the course of the disease, the virus invaded The deep-level path and the reasons for the evolution and mutation of the new coronavirus and the particularity of prevention and treatment, etc.). Therefore, human beings should be highly vigilant and must not be taken lightly. The fierce battle between humans and various viruses must not be slackened. Greater efforts are needed to successfully overcome this pandemic, fully restore the normal life of the whole society, restore the normal production and work order, restore the normal operation of society, economy and culture, and give up food due to choking. Or eager for success, will pay a high price.
———————————————————————————————————————————————— ————
References References are made to web resources, and related images are from web resources and related websites.
Who official website UN .org www.gavi.org/ispe.org
Wikipedia, "The Lancet", "English Journal of Medicine", "Nature", "Science", "Journal of the American Medical Association", etc.
Learning from history: do not flatten the curve of antiviral research!
T Bobrowski, CC Melo-Filho, D Korn, VM Alves...-Drug discovery today, 2020-
A critical overview of computational approaches employed for COVID-19 drug discovery
EN Muratov, R Amaro, CH Andrade, N Brown...-Chemical Society..., 2021-pubs.rsc.org
Global Research Performance on COVID 19 in Dimensions Database
J Balasubramani, M Anbalagan-2021-researchgate.net
Adoption of a contact tracing app for containing COVID-19: a health belief model approach
M Walrave, C Waeterloos...- JMIR public health and..., 2020-publichealth.jmir.org
Prophylactic Treatment Protocol Against the Severity of COVID-19 Using Melatonin
N Charaa, M Chahed, H Ghedira...-Available at SSRN..., 2020-papers.ssrn.com
Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China, The Lancet
Transmission of 2019-nCoV Infection from an Asymptomatic Contact in Germany, New England Journal of Medicine
The actions of respiratory therapists facing COVID-19
Zhu Jiacheng-Respiratory Therapy, 2021-pesquisa.bvsalud.org
Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study, The Lancet
Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus–Infected Pneumonia in Wuhan, China, JAMA, February 7
Epidemiologic and Clinical Characteristics of Novel Coronavirus Infections Involving 13 Patients Outside Wuhan, China, JAMA
Delta variant triggers new phase in the pandemic | Science
science.sciencemag.org›
COVID vaccines slash viral spread – but Delta is an unknown
www.nature.com ›articles
Novel coronavirus pneumonia during ophthalmic surgery management strategy and recommendations
YH HUANG, SS LI, X YAO, YR YANG, DH QIN…-jnewmed.com
Delta variant: What is happening with transmission, hospital ...
Risk of long QT syndrome in novel coronavirus COVID-19
VN Oslopov, JV Oslopova, EV Hazova…-Kazan medical…, 2020-kazanmedjournal.ru
Study compares mRNA and adenovirus-based SARS-CoV-2 vaccines ...
First molecular-based detection of SARS-CoV-2 virus in the field-collected houseflies
A Soltani, M Jamalidoust, A Hosseinpour, M Vahedi...-Scientific Reports, 2021-nature.com
Covid 19 DELTA Variant Archives-Online essay writing service
sourceessay.com ›tag› covid-19-delta-variant
SARS-CoV-2 Delta variant Likely to become dominant in the ...
Compilation postscript
Once Fang Ruida's research literature on the new crown virus and mutant virus was published, it has been enthusiastically praised by readers and netizens in dozens of countries around the world, and has proposed some amendments and suggestions. Hope to publish a multilingual version of the book as an emergency To meet the needs of many readers around the world, in the face of the new crown epidemic and the prevention and treatment of various mutant viruses, including the general public, college and middle school students, medical workers, medical colleagues and so on. According to the English original manuscript, it will be re-compiled and published. Inconsistencies will be revised separately. Thank you very much.
Jacques Lucy, Geneva, Switzerland, August 2021
*********************************************************************
Leader mondial, scientifique, scientifique médical, virologue, pharmacien et professeur Fangruida (F.D Smith) sur l'épidémie mondiale et l'ennemi juré et la prévention des nouveaux coronavirus et virus mutants (Jacques Lucy 2021v1.5)
_-----------------------------------------
L'ennemi juré et le tueur du nouveau coronavirus et des virus mutés - Développement conjoint de vaccins et de médicaments (Fangruida) Juillet 2021
* La particularité des nouveaux coronavirus et des virus mutants * Le large spectre, la haute efficacité, la redondance et la sécurité de la conception et du développement du nouveau vaccin contre le coronavirus, Redondance et sécurité
* Nouvelle modification de la structure chimique des médicaments contre les coronavirus * Conception et dépistage des médicaments assistés par ordinateur. *"Missile biologique antiviral", "Nouveaux comprimés anti-épidémiques contre le coronavirus", "Liquide oral antiviral composite", "Nouveaux comprimés oraux à action prolongée contre le coronavirus", "Nouveaux inhibiteurs de coronavirus" (injection)
——————————————————————————
(leader mondial, scientifique, scientifique médical, biologiste, virologue, pharmacien, FD Smith) "The Nemesis and Killer of New Coronavirus and Mutated Viruses-The Joint Development of Vaccines and Drugs" est un important document de recherche scientifique. Il a maintenant été révisé et réédité par l'auteur original à plusieurs reprises. La compilation est publiée et publiée selon le manuscrit original pour répondre aux besoins des lecteurs et des internautes du monde entier. En même temps, elle est également très bénéfique pour le grand nombre de chercheurs en médicaments cliniques médicaux et de divers experts et universitaires. Nous espérons qu'il sera corrigé dans la réimpression.------Compilé par Jacques Lucy à Genève, août 2021
-------------------------------------------------- ---------------------
Selon les statistiques en temps réel de Worldometer, vers 6h30 le 23 juillet, il y avait un total de 193 323 815 cas confirmés de nouvelle pneumonie coronarienne dans le monde, et un total de 4 150 213 décès. Il y a eu 570 902 nouveaux cas confirmés et 8 766 nouveaux décès dans le monde en une seule journée. Les données montrent que les États-Unis, le Brésil, le Royaume-Uni, l'Inde et l'Indonésie sont les cinq pays avec le plus grand nombre de nouveaux cas confirmés, et l'Indonésie, le Brésil, la Russie, l'Afrique du Sud et l'Inde sont les cinq pays avec le plus grand nombre de nouveaux décès.
Les nouvelles souches de coronavirus et de mutants delta ont été particulièrement graves ces derniers temps. De nombreux pays et lieux ont repris vie et le nombre de cas n'a pas diminué, mais a augmenté.
, Il est digne de vigilance. Bien que de nombreux pays aient renforcé la prévention et le contrôle des vaccins et d'autres mesures de prévention et de contrôle, il existe encore de nombreuses lacunes et carences dans la suppression et la prévention du virus. Le nouveau coronavirus et diverses souches mutantes présentent un certain degré d'antagonisme par rapport aux médicaments traditionnels et à la plupart des vaccins. Bien que la plupart des vaccins aient de grandes propriétés anti-épidémiques et aient des effets et une protection importants et irremplaçables pour la prévention et le traitement, il est impossible d'empêcher complètement la propagation et l'infection des virus. La propagation de la nouvelle pneumonie à virus couronne a été retardée de près de deux ans. Il y a des centaines de millions de personnes infectées dans le monde, des millions de décès, et le temps est long, la propagation est généralisée et des milliards de personnes dans le monde sont parmi Les dommages causés par le virus sont assez terribles, c'est bien connu. Plus urgent
Ce qui est plus grave, c'est que le virus et les souches mutantes n'ont pas complètement reculé, surtout que de nombreuses personnes sont encore infectées et infectées après avoir été injectées avec divers vaccins.L'efficacité du vaccin et la résistance du virus mutant sont dignes des scientifiques médicaux, virologues , les pharmacologues Les zoologistes et autres réfléchissent et analysent sérieusement. La situation épidémique actuelle dans les pays européens et américains, la Chine, le Brésil, l'Inde, les États-Unis, la Russie et d'autres pays s'est considérablement améliorée par rapport à l'année dernière.Cependant, les chiffres pertinents montrent que la situation épidémique mondiale ne s'est pas complètement améliorée, et certains pays et régions sont encore très graves. En particulier, après une utilisation intensive de divers vaccins, des cas surviennent encore, et dans certains endroits ils sont encore très graves, ce qui mérite une grande vigilance. Les mesures de prévention et de contrôle sont très importantes.De plus, les vaccins et divers médicaments antiépidémiques sont les premiers choix nécessaires, et les autres méthodes sont irremplaçables. Il est particulièrement important de développer et de développer des médicaments complets, des médicaments antiviraux, des médicaments immunitaires et des médicaments génétiques. Les expériences de recherche sur les nouveaux coronavirus et virus mutants nécessitent une analyse plus rigoureuse et approfondie des données, des tissus pathogènes pathologiques, des gènes cellulaires, de la chimie moléculaire, de la chimie quantique, etc., ainsi que de la chimie moléculaire des vaccins, de la physique quantique, de la biologie quantique, de l'histologie cytologique, la chimie médicinale et les médicaments Et les symptômes, l'efficacité, la sécurité, l'efficacité à long terme, etc. du vaccin, bien sûr, y compris des dizaines de milliers de cas cliniques et de décès et d'autres informations et preuves de première main. La tâche de l'ARN (acide ribonucléique) dans le corps humain est d'utiliser les informations de notre matériel génétique ADN pour produire des protéines. Il accomplit cette tâche dans le ribosome, la zone productrice de protéines de la cellule. Le ribosome est le lieu où se produit la biosynthèse des protéines.
La médecine en profite : dans la vaccination, l'ARNm produit artificiellement fournit aux ribosomes des instructions pour construire des antigènes pathogènes contre lesquels lutter, par exemple, la protéine de pointe du coronavirus.
Les vaccins vivants traditionnels ou les vaccins inactivés contiennent des antigènes qui provoquent la réaction du système immunitaire. Le vaccin à ARNm est produit dans la cellule
(1) La spécificité des nouveaux coronavirus et virus mutants, etc., virologie et chimie quantique des virus mutants, physique quantique, microbiologie quantique
(2) Nouvelle conception de vaccin couronne, biologie moléculaire et structure chimique, etc.
(3) La généralité et la particularité du développement de nouveaux médicaments contre le coronavirus
(4) Diverses conceptions de médicaments pour la pneumonie à nouveau coronavirus, la chimie médicinale, la pharmacologie, etc., les cellules, les protéines, l'ADN, la chimie des enzymes, la chimie quantique pharmaceutique, la physique quantique pharmaceutique, la biochimie humaine, la biophysique humaine, etc.
(5) Les caractéristiques d'évolution et de mutation du nouveau coronavirus et de divers virus mutants, la nature à long terme, la répétabilité, la résistance aux médicaments et la résistance épidémique du virus, etc.
(6) Pneumonie à nouveau coronavirus et transmission infectieuse de divers nouveaux coronavirus et leurs particularités
(7) La transmission invisible de la pneumonie à nouveau coronavirus et de divers virus mutants chez l'homme ou l'animal, et la symbiose mutuelle de l'infection croisée de diverses bactéries et virus sont également l'une des causes très graves de dommages graves aux nouveaux coronavirus et virus mutants. La virologie, la pathologie, l'étiologie, le séquençage des gènes, la cartographie des gènes et un grand nombre d'études analytiques ont montré qu'il existe de nombreux cas en Chine, aux États-Unis, en Inde, en Russie, au Brésil et dans d'autres pays.
(8) Pour la prévention et le traitement symptomatiques du nouveau coronavirus, la combinaison de divers vaccins et de di
Mingle Media TV and Red Carpet Report host Paige Sullivan were invited to come back and cover the 2nd Annual Rebels with a Cause Gala at Paramount Studios honoring Larry Ellison with Jimmy Kimmel hosting and special guest performances by Barry Manilow and Pharrell Williams. This event supports the lifesaving research of David B. Agus, M.D. at USC’s Center for Applied Molecular Medicine.
Get the Story from the Red Carpet Report Team, follow us on Twitter and Facebook at:
www.facebook.com/RedCarpetReportTV
www.youtube.com/MingleMediaTVNetwork
ABOUT THE USC CENTER FOR APPLIED MOLECULAR MEDICINE
The principal goal of the USC Center for Applied Molecular Medicine is the development of novel treatment strategies for cancer. The Center was implemented to enable a convergence of multiple disciplines to work on treatment and the care of patients with cancer. The program includes the clinical care of patients with cancer at the USC Westside Cancer Center in Beverly Hills and has team members with expertise spanning cancer biology, biochemistry, molecular biology, bioinformatics, computer science, electrical engineering, bioorganic chemistry, physics and applied mathematics. For information, visit camm.usc.edu/.
For more of Mingle Media TV’s Red Carpet Report coverage, please visit our website and follow us on Twitter and Facebook here:
www.facebook.com/minglemediatvnetwork
www.flickr.com/MingleMediaTVNetwork
Follow our host Paige Sullivan on Twitter at twitter.com/PaigeSull
World leader, scientist, medical scientist, virologist, pharmacist, Professor Fangruida (F.D Smith) on the world epidemic and the nemesis and prevention of new coronaviruses and mutant viruses (Jacques Lucy) 2021v1.5)
_-----------------------------------------
The Nemesis and Killer of New Coronavirus and Mutated Viruses-Joint Development of Vaccines and Drugs (Fangruida) July 2021
*The particularity of new coronaviruses and mutant viruses*The broad spectrum, high efficiency, redundancy, and safety of the new coronavirus vaccine design and development , Redundancy and safety
*New coronavirus drug chemical structure modification*Computer-aided design and drug screening. *"Antiviral biological missile", "New Coronavirus Anti-epidemic Tablets", "Composite Antiviral Oral Liquid", "New Coronavirus Long-acting Oral Tablets", "New Coronavirus Inhibitors" (injection)
——————————————————————————
(World leader, scientist, medical scientist, biologist, virologist, pharmacist, FD Smith) "The Nemesis and Killer of New Coronavirus and Mutated Viruses-The Joint Development of Vaccines and Drugs" is an important scientific research document. Now it has been revised and re-published by the original author several times. The compilation is published and published according to the original manuscript to meet the needs of readers and netizens all over the world. At the same time, it is also of great benefit to the vast number of medical clinical drug researchers and various experts and scholars. We hope that it will be corrected in the reprint.------Compiled by Jacques Lucy in Geneva, August 2021
-------------------------------------------------- ---------------------
According to Worldometer's real-time statistics, as of about 6:30 on July 23, there were a total of 193,323,815 confirmed cases of new coronary pneumonia worldwide, and a total of 4,150,213 deaths. There were 570,902 new confirmed cases and 8,766 new deaths worldwide in a single day. Data shows that the United States, Brazil, the United Kingdom, India, and Indonesia are the five countries with the largest number of new confirmed cases, and Indonesia, Brazil, Russia, South Africa, and India are the five countries with the largest number of new deaths.
The new coronavirus and delta mutant strains have been particularly serious in the recent past. Many countries and places have revived, and the number of cases has not decreased, but has increased.
, It is worthy of vigilance. Although many countries have strengthened vaccine prevention and control and other prevention and control measures, there are still many shortcomings and deficiencies in virus suppression and prevention. The new coronavirus and various mutant strains have a certain degree of antagonism to traditional drugs and most vaccines. Although most vaccines have great anti-epidemic properties and have important and irreplaceable effects and protection for prevention and treatment, it is impossible to completely prevent the spread and infection of viruses. The spread of the new crown virus pneumonia has been delayed for nearly two years. There are hundreds of millions of people infected worldwide, millions of deaths, and the time is long, the spread is widespread, and billions of people around the world are among them. The harm of the virus is quite terrible. This is well known. of. More urgent
What is more serious is that the virus and mutant strains have not completely retreated, especially many people are still infected and infected after being injected with various vaccines. The effectiveness of the vaccine and the resistance of the mutant virus are worthy of medical scientists, virologists, pharmacologists Zoologists and others seriously think and analyze. The current epidemic situation in European and American countries, China, Brazil, India, the United States, Russia and other countries has greatly improved from last year. However, relevant figures show that the global epidemic situation has not completely improved, and some countries and regions are still very serious. In particular, after extensive use of various vaccines, cases still occur, and in some places they are still very serious, which deserves a high degree of vigilance. Prevention and control measures are very important. In addition, vaccines and various anti-epidemic drugs are the first and necessary choices, and other methods are irreplaceable. It is particularly important to develop and develop comprehensive drugs, antiviral drugs, immune drugs, and genetic drugs. Research experiments on new coronaviruses and mutant viruses require more rigorous and in-depth data analysis, pathological pathogenic tissues, cell genes, molecular chemistry, quantum chemistry, etc., as well as vaccine molecular chemistry, quantum physics, quantum biology, cytological histology, medicinal chemistry, and drugs And the vaccine’s symptomatic, effectiveness, safety, long-term effectiveness, etc., of course, including tens of thousands of clinical cases and deaths and other first-hand information and evidence. The task of RNA (ribonucleic acid) in the human body is to use the information of our genetic material DNA to produce protein. It accomplishes this task in the ribosome, the protein-producing area of the cell. The ribosome is the place where protein biosynthesis occurs.
Medicine takes advantage of this: In vaccination, artificially produced mRNA provides ribosomes with instructions for constructing pathogen antigens to fight against—for example, the spike protein of coronavirus.
Traditional live vaccines or inactivated vaccines contain antigens that cause the immune system to react. The mRNA vaccine is produced in the cell
(1) The specificity of new coronaviruses and mutant viruses, etc., virology and quantum chemistry of mutant viruses, quantum physics, quantum microbiology
(2) New crown vaccine design, molecular biology and chemical structure, etc.
(3) The generality and particularity of the development of new coronavirus drugs
(4) Various drug design for new coronavirus pneumonia, medicinal chemistry, pharmacology, etc., cells, proteins, DNA, enzyme chemistry, pharmaceutical quantum chemistry, pharmaceutical quantum physics, human biochemistry, human biophysics, etc.
(5) The evolution and mutation characteristics of the new coronavirus and various mutant viruses, the long-term nature, repeatability, drug resistance, and epidemic resistance of the virus, etc.
(6) New coronavirus pneumonia and the infectious transmission of various new coronaviruses and their particularities
(7) The invisible transmission of new coronavirus pneumonia and various mutant viruses in humans or animals, and the mutual symbiosis of cross infection of various bacteria and viruses are also one of the very serious causes of serious harm to new coronaviruses and mutant viruses. Virology, pathology, etiology, gene sequencing, gene mapping, and a large number of analytical studies have shown that there are many cases in China, the United States, India, Russia, Brazil, and other countries.
(8) For the symptomatic prevention and treatment of the new coronavirus, the combination of various vaccines and various antiviral drugs is critical.
(9) According to the current epidemic situation and research judgments, the epidemic situation may improve in the next period of time and 2021-2022, and we are optimistic about its success. However, completely worry-free, it is still too early to win easily. It is not just relying on vaccination. Wearing masks to close the city and other prevention and control measures and methods can sit back and relax, and you can win a big victory. Because all kinds of research and exploration still require a lot of time and various experimental studies. It is not a day's work. A simple taste is very dangerous and harmful. The power and migratory explosiveness of viruses sometimes far exceed human thinking and perception. In the future, next year, or in the future, whether viruses and various evolutionary mutation viruses will re-attack, we still need to study, analyze, prevent and control, rather than being complacent, thinking that the vaccine can win a big victory is inevitably naive and ridiculous. Vaccine protection is very important, but it must not be taken carelessly. The mutation of the new crown virus is very rampant, and the cross-infection of recessive and virulent bacteria makes epidemic prevention and anti-epidemic very complicated.
(10) New crown virus pneumonia and the virus's stubbornness, strength, migration, susceptibility, multi-infectiousness, and occult. The effectiveness of various vaccines and the particularity of virus mutations The long-term hidden dangers and repeated recurrences of the new coronavirus
(11) The formation mechanism and invisible transmission of invisible viruses, asymptomatic infections and asymptomatic infections, asymptomatic transmission routes, asymptomatic infections, pathological pathogens. The spread and infection of viruses and mutated viruses, the blind spots and blind spots of virus vaccines, viral quantum chemistry and
The chemical and physical corresponding reactions at the meeting points of highly effective vaccine drugs, etc. The variability of mutated viruses is very complicated, and vaccination cannot completely prevent the spread of infection.
(12) New crown virus pneumonia and various respiratory infectious diseases are susceptible to infections in animals and humans, and are frequently recurring. This is one of the frequently-occurring and difficult diseases of common infectious diseases. Even with various vaccines and various antiviral immune drugs, it is difficult to completely prevent the occurrence and spread of viral pneumonia. Therefore, epidemic prevention and anti-epidemic is a major issue facing human society, and no country should take it lightly. The various costs that humans pay on this issue are very expensive, such as Ebola virus, influenza A virus,
Hepatitis virus,
Marburg virus
Sars coronavirus, plague, anthracnose, cholera
and many more. The B.1.1.7 mutant virus that was first discovered in the UK was renamed Alpha mutant virus; the B.1.351 that was first discovered in South Africa was renamed Beta mutant virus; the P.1 that was first discovered in Brazil was renamed Gamma mutant virus; the mutation was first discovered in India There are two branches of the virus. B.1.617.2, which was listed as "mutated virus of concern", was renamed Delta mutant virus, and B.1.617.1 of "mutated virus to be observed" was renamed Kappa mutant virus.
However, experts in many countries believe that the current vaccination is still effective, at least it can prevent severe illness and reduce deaths.
Delta mutant strain
According to the degree of risk, the WHO divides the new crown variant strains into two categories: worrying variant strains (VOC, variant of concern) and noteworthy variant strains (VOI, variant of interest). The former has caused many cases and a wide range of cases worldwide, and data confirms its transmission ability, strong toxicity, high power, complex migration, and high insidious transmission of infection. Resistance to vaccines may lead to the effectiveness of vaccines and clinical treatments. Decrease; the latter has confirmed cases of community transmission worldwide, or has been found in multiple countries, but has not yet formed a large-scale infection. Need to be very vigilant. Various cases and deaths in many countries in the world are related to this. In some countries, the epidemic situation is repeated, and it is also caused by various reasons and viruses, of course, including new cases and so on.
At present, VOC is the mutant strain that has the greatest impact on the epidemic and the greatest threat to the world, including: Alpha, Beta, Gamma and Delta. , Will the change of the spur protein in the VOC affect the immune protection effect of the existing vaccine, or whether it will affect the sensitivity of the VOC to the existing vaccine? For this problem, it is necessary to directly test neutralizing antibodies, such as those that can prevent the protection of infection. Antibodies recognize specific protein sequences on viral particles, especially those spike protein sequences used in mRNA vaccines.
(13) Countries around the world, especially countries and regions with more severe epidemics, have a large number of clinical cases, severe cases, and deaths, especially including many young and middle-aged patients, including those who have been vaccinated. The epidemic is more complicated and serious. Injecting various vaccines, taking strict control measures such as closing the city and wearing masks are very important and the effect is very obvious. However, the new coronavirus and mutant viruses are so repeated, their pathological pathogen research will also be very complicated and difficult. After the large-scale use of the vaccine, many people are still infected. In addition to the lack of prevention and control measures, it is very important that the viability of the new coronavirus and various mutant viruses is very important. It can escape the inactivation of the vaccine. It is very resistant to stubbornness. Therefore, the recurrence of new coronavirus pneumonia is very dangerous. What is more noteworthy is that medical scientists, virologists, pharmacists, biologists, zoologists and clinicians should seriously consider the correspondence between virus specificity and vaccine drugs, and the coupling of commonality and specificity. Only in this way can we find targets. Track and kill viruses. Only in this sense can the new crown virus produce a nemesis, put an end to and eradicate the new crown virus pneumonia. Of course, this is not a temporary battle, but a certain amount of time and process to achieve the goal in the end.
(14) The development and evolution of the natural universe and earth species, as well as life species. With the continuous evolution of human cell genes, microbes and bacterial viruses are constantly mutated and inherited. The new world will inevitably produce a variety of new pathogens.
And viruses. For example, neurological genetic disease, digestive system disease, respiratory system disease, blood system disease, cardiopulmonary system disease, etc., new diseases will continue to emerge as humans develop and evolve. Human migration to space, space diseases, space psychological diseases, space cell diseases, space genetic diseases, etc. Therefore, for the new coronavirus and mutated viruses, we must have sufficient knowledge and response, and do not think that it will be completely wiped out.
, And is not a scientific attitude. Viruses and humans mutually reinforce each other, and viruses and animals and plants mutually reinforce each other. This is the iron law of the natural universe. Human beings can only adapt to natural history, but cannot deliberately modify natural history.
Active immune products made from specific bacteria, viruses, rickettsiae, spirochetes, mycoplasma and other microorganisms and parasites are collectively called vaccines. Vaccination of animals can make the animal body have specific immunity. The principle of vaccines is to artificially attenuate, inactivate, and genetically attenuate pathogenic microorganisms (such as bacteria, viruses, rickettsia, etc.) and their metabolites. Purification and preparation methods, made into immune preparations for the prevention of infectious diseases. In terms of ingredients, the vaccine retains the antigenic properties and other characteristics of the pathogen, which can stimulate the body's immune response and produce protective antibodies. But it has no pathogenicity and does not cause harm to the body. When the body is exposed to this pathogen again, the immune system will produce more antibodies according to the previous memory to prevent the pathogen from invading or to fight against the damage to the body. (1) Inactivated vaccines: select pathogenic microorganisms with strong immunogenicity, culture them, inactivate them by physical or chemical methods, and then purify and prepare them. The virus species used in inactivated vaccines are generally virulent strains, but the use of attenuated attenuated strains also has good immunogenicity, such as the inactivated polio vaccine produced by the Sabin attenuated strain. The inactivated vaccine has lost its infectivity to the body, but still maintains its immunogenicity, which can stimulate the body to produce corresponding immunity and resist the infection of wild strains. Inactivated vaccines have a good immune effect. They can generally be stored for more than one year at 2~8°C without the risk of reversion of virulence; however, the inactivated vaccines cannot grow and reproduce after entering the human body. They stimulate the human body for a short time and must be strong and long-lasting. In general, adjuvants are required for immunity, and multiple injections in large doses are required, and the local immune protection of natural infection is lacking. Including bacteria, viruses, rickettsiae and toxoid preparations.
(2) Live attenuated vaccine: It is a vaccine made by using artificial targeted mutation methods or by screening live microorganisms with highly weakened or basically non-toxic virulence from the natural world. After inoculation, the live attenuated vaccine has a certain ability to grow and reproduce in the body, which can cause the body to have a reaction similar to a recessive infection or a mild infection, and it is widely used.
(3) Subunit vaccine: Among the multiple specific antigenic determinants carried by macromolecular antigens, only a small number of antigenic sites play an important role in the protective immune response. Separate natural proteins through chemical decomposition or controlled proteolysis, and extract bacteria and virusesVaccines made from fragments with immunological activity are screened out of the special protein structure of, called subunit vaccines. Subunit vaccines have only a few major surface proteins, so they can eliminate antibodies induced by many unrelated antigens, thereby reducing the side effects of the vaccine and related diseases and other side effects caused by the vaccine. (4) Genetically engineered vaccine: It uses DNA recombination biotechnology to direct the natural or synthetic genetic material in the pathogen coat protein that can induce the body's immune response into bacteria, yeast or mammalian cells to make it fully expressed. A vaccine prepared after purification. The application of genetic engineering technology can produce subunit vaccines that do not contain infectious substances, stable attenuated vaccines with live viruses as carriers, and multivalent vaccines that can prevent multiple diseases. This is the second-generation vaccine following the first-generation traditional vaccine. It has the advantages of safety, effectiveness, long-term immune response, and easy realization of combined immunization. It has certain advantages and effects.
New coronavirus drug development, drug targets and chemical modification.
Ligand-based drug design (or indirect drug design planning) relies on the knowledge of other molecules that bind to the target biological target. These other molecules can be used to derive pharmacophore models and structural modalities, which define the minimum necessary structural features that the molecule must have in order to bind to the target. In other words, a model of a biological target can be established based on the knowledge of the binding target, and the model can be used to design new molecular entities and other parts that interact with the target. Among them, the quantitative structure-activity relationship (QSAR) is included, in which the correlation between the calculated properties of the molecule and its experimentally determined biological activity can be derived. These QSAR relationships can be used to predict the activity of new analogs. The structure-activity relationship is very complicated.
Based on structure
Structure-based drug design relies on knowledge of the three-dimensional structure of biological targets obtained by methods such as X-ray crystallography or NMR spectroscopy and quantum chemistry. If the experimental structure of the target is not available, it is possible to create a homology model of the target and other standard models that can be compared based on the experimental structure of the relevant protein. Using the structure of biological targets, interactive graphics and medical chemists’ intuitive design can be used to predict drug candidates with high affinity and selective binding to the target. Various automatic calculation programs can also be used to suggest new drug candidates.
The current structure-based drug design methods can be roughly divided into three categories. The 3D method is to search a large database of small molecule 3D structures to find new ligands for a given receptor, in order to use a rapid approximate docking procedure to find those suitable for the receptor binding pocket. This method is called virtual screening. The second category is the de novo design of new ligands. In this method, by gradually assembling small fragments, a ligand molecule is established within the constraints of the binding pocket. These fragments can be single atoms or molecular fragments. The main advantage of this method is that it can propose novel structures that are not found in any database. The third method is to optimize the known ligand acquisition by evaluating the proposed analogs in the binding cavity.
Bind site ID
Binding site recognition is a step in structure-based design. If the structure of the target or a sufficiently similar homologue is determined in the presence of the bound ligand, the ligand should be observable in that structure, in which case the location of the binding site is small. However, there may not be an allosteric binding site of interest. In addition, only apo protein structures may be available, and it is not easy to reliably identify unoccupied sites that have the potential to bind ligands with high affinity. In short, the recognition of binding sites usually depends on the recognition of pits. The protein on the protein surface can hold molecules the size of drugs, etc. These molecules also have appropriate "hot spots" that drive ligand binding, hydrophobic surfaces, hydrogen bonding sites, and so on.
Drug design is a creative process of finding new drugs based on the knowledge of biological targets. The most common type of drug is small organic molecules that activate or inhibit the function of biomolecules, thereby producing therapeutic benefits for patients. In the most important sense, drug design involves the design of molecules with complementary shapes and charges that bind to their interacting biomolecular targets, and therefore will bind to them. Drug design often but does not necessarily rely on computer modeling techniques. A more accurate term is ligand design. Although the design technology for predicting binding affinity is quite successful, there are many other characteristics, such as bioavailability, metabolic half-life, side effects, etc., which must be optimized first before the ligand can become safe and effective. drug. These other features are usually difficult to predict and realize through reasonable design techniques. However, due to the high turnover rate, especially in the clinical stage of drug development, in the early stage of the drug design process, more attention is paid to the selection of drug candidates. The physical and chemical properties of these drug candidates are expected to be reduced during the development process. Complications are therefore more likely to lead to the approval of the marketed drug. In addition, in early drug discovery, in vitro experiments with computational methods are increasingly used to select compounds with more favorable ADME (absorption, distribution, metabolism, and excretion) and toxicological characteristics. A more accurate term is ligand design. Although the design technique for predicting binding affinity is quite successful, there are many other characteristics, such as bioavailability, metabolic half-life, side effects, iatrogenic effects, etc., which must be optimized first, and then the ligand To become safe and effective.
For drug targets, two aspects should be considered when selecting drug targets:
1. The effectiveness of the target, that is, the target is indeed related to the disease, and the symptoms of the disease can be effectively improved by regulating the physiological activity of the target.
2. The side effects of the target. If the regulation of the physiological activity of the target inevitably produces serious side effects, it is inappropriate to select it as the target of drug action or lose its important biological activity. The reference frame of the target should be expanded in multiple dimensions to have a big choice.
3. Search for biomolecular clues related to diseases: use genomics, proteomics and biochip technology to obtain biomolecular information related to diseases, and perform bioinformatics analysis to obtain clue information.
4. Perform functional research on related biomolecules to determine the target of candidate drugs. Multiple targets or individual targets.
5. Candidate drug targets, design small molecule compounds, and conduct pharmacological research at the molecular, cellular and overall animal levels.
Covalent bonding type
The covalent bonding type is an irreversible form of bonding, similar to the organic synthesis reaction that occurs. Covalent bonding types mostly occur in the mechanism of action of chemotherapeutic drugs. For example, alkylating agent anti-tumor drugs produce covalent bonding bonds to guanine bases in DNA, resulting in cytotoxic activity.
. Verify the effectiveness of the target.
Based on the targets that interact with drugs, that is, receptors in a broad sense, such as enzymes, receptors, ion channels, membranes, antigens, viruses, nucleic acids, polysaccharides, proteins, enzymes, etc., find and design reasonable drug molecules. Targets of action and drug screening should focus on multiple points. Drug intermediates and chemical modification. Combining the development of new drugs with the chemical structure modification of traditional drugs makes it easier to find breakthroughs and develop new antiviral drugs. For example, careful selection, modification and modification of existing related drugs that can successfully treat and recover a large number of cases, elimination and screening of invalid drugs from severe death cases, etc., are targeted, rather than screening and capturing needles in a haystack, aimless, with half the effort. Vaccine design should also be multi-pronged and focused. The broad-spectrum, long-term, safety, efficiency and redundancy of the vaccine should all be considered. In this way, it will be more powerful to deal with the mutation and evolution of the virus. Of course, series of vaccines, series of drugs, second-generation vaccines, third-generation vaccines, second-generation drugs, third-generation drugs, etc. can also be developed. Vaccines focus on epidemic prevention, and medicines focus on medical treatment. The two are very different; however, the two complement each other and complement each other. Therefore, in response to large-scale epidemics of infectious diseases, vaccines and various drugs are the nemesis and killers of viral diseases. Of course, it also includes other methods and measures, so I won't repeat them here.
Mainly through the comprehensive and accurate understanding of the structure of the drug and the receptor at the molecular level and even the electronic level, structure-based drug design and the understanding of the structure, function, and drug action mode of the target and the mechanism of physiological activity Mechanism-based drug design.
Compared with the traditional extensive pharmacological screening and lead compound optimization, it has obvious advantages.
Viral RNA replicase, also known as RNA-dependent RNA polymerase (RdRp) is responsible for the replication and transcription of RNA virus genome, and plays a very important role in the process of virus self-replication in host cells, and It also has a major impact on the mutation of the virus, it will change and accelerate the replication and recombination. Because RdRp from different viruses has a highly conserved core structure, the virus replicase is an important antiviral drug target and there are other selection sites, rather than a single isolated target target such as the new coronavirus As with various mutant viruses, inhibitors developed for viral replicase are expected to become a broad-spectrum antiviral drug. The currently well-known anti-coronavirus drug remdesivir (remdesivir) is a drug for viral replicase.
New antiviral therapies are gradually emerging. In addition to traditional polymerase and protease inhibitors, nucleic acid drugs, cell entry inhibitors, nucleocapsid inhibitors, and drugs targeting host cells are also increasingly appearing in the research and development of major pharmaceutical companies. The treatment of mutated viruses is becoming increasingly urgent. The development of drugs for the new coronavirus pneumonia is very important. It is not only for the current global new coronavirus epidemic, but more importantly, it is of great significance to face the severe pneumonia-respiratory infectious disease that poses a huge threat to humans.
There are many vaccines and related drugs developed for the new coronavirus pneumonia, and countries are vying for a while, mainly including the following:
Identification test, appearance, difference in loading, moisture, pH value, osmolality, polysaccharide content, free polysaccharide content, potency test, sterility test, pyrogen test, bacterial endotoxin test, abnormal toxicity test.
Among them: such as sterility inspection, pyrogen inspection, bacterial endotoxin, and abnormal toxicity inspection are indicators closely related to safety.
Polysaccharide content, free polysaccharide content, and efficacy test are indicators closely related to vaccine effectiveness.
Usually, a vaccine will go through a long research and development process of at least 8 years or even more than 20 years from research and development to marketing. The outbreak of the new crown epidemic requires no delay, and the design and development of vaccines is speeding up. It is not surprising in this special period. Of course, it is understandable that vaccine design, development and testing can be accelerated, shortened the cycle, and reduced some procedures. However, science needs to be rigorous and rigorous to achieve great results. The safety and effectiveness of vaccines are of the utmost importance. There must not be a single error. Otherwise, it will be counterproductive and need to be continuously improved and perfected.
Pre-clinical research: The screening of strains and cells is the basic guarantee to ensure the safety, effectiveness, and continuous supply of vaccines. Taking virus vaccines as an example, the laboratory stage needs to carry out strain screening, necessary strain attenuation, strain adaptation to the cultured cell matrix and stability studies in the process of passaging, and explore the stability of process quality, establish animal models, etc. . Choose mice, guinea pigs, rabbits or monkeys for animal experiments according to each vaccine situation. Pre-clinical research generally takes 5-10 years or longer on the premise that the process is controllable, the quality is stable, and it is safe and effective. In order to be safe and effective, a certain redundant design is also needed, so that the safety and effectiveness of the vaccine can be importantly guaranteed.
These include the establishment of vaccine strain/cell seed bank, production process research, quality research, stability research, animal safety evaluation and effectiveness evaluation, and clinical trial programs, etc.
The ARS-CoV-2 genome contains at least 10 ORFs. ORF1ab is converted into a polyprotein and processed into 16 non-structural proteins (NSP). These NSPs have a variety of functional biological activities, physical and chemical reactions, such as genome replication, induction of host mRNA cleavage, membrane rearrangement, autophagosome production, NSP polyprotein cleavage, capping, tailing, methylation, RNA double-stranded Uncoiling, etc., and others, play an important role in the virus life cycle. In addition, SARS-CoV-2 contains 4 structural proteins, namely spike (S), nucleocapsid (N), envelope (E) and membrane (M), all of which are encoded by the 3'end of the viral genome. Among the four structural proteins, S protein is a large multifunctional transmembrane protein that plays an important role in the process of virus adsorption, fusion, and injection into host cells, and requires in-depth observation and research.
1S protein is composed of S1 and S2 subunits, and each subunit can be further divided into different functional domains. The S1 subunit has 2 domains: NTD and RBD, and RBD contains conservative RBM. The S2 subunit has 3 structural domains: FP, HR1 and HR2. The S1 subunit is arranged at the top of the S2 subunit to form an immunodominant S protein.
The virus uses the host transmembrane protease Serine 2 (TMPRSS2) and the endosomal cysteine protease CatB/L to enter the cell. TMPRSS2 is responsible for the cleavage of the S protein to expose the FP region of the S2 subunit, which is responsible for initiating endosome-mediated host cell entry into it. It shows that TMPRSS2 is a host factor necessary for virus entry. Therefore, the use of drugs that inhibit this protease can achieve the purpose of treatment.
mRNA-1273
The mRNA encoding the full length of SARS-CoV-2, and the pre-spike protein fusion is encapsulated into lipid nanoparticles to form mRNA-1273 vaccine. It can induce a high level of S protein specific antiviral response. It can also consist of inactivated antigens or subunit antigens. The vaccine was quickly approved by the FDA and has entered phase II clinical trials. The company has announced the antibody data of 8 subjects who received different immunization doses. The 25ug dose group achieved an effect similar to the antibody level during the recovery period. The 100ug dose group exceeded the antibody level during the recovery period. In the 25ug and 100ug dose groups, the vaccine was basically safe and tolerable, while the 250ug dose group had 3 levels of systemic symptoms.
Viral vector vaccines can provide long-term high-level expression of antigen proteins, induce CTLs, and ultimately eliminate viral infections.
1, Ad5-nCov
A vaccine of SARS-CoV-2 recombinant spike protein expressed by recombinant, replication-deficient type 5 adenovirus (Ad5) vector. Load the optimized full-length S protein gene together with the plasminogen activation signal peptide gene into the E1 and E3 deleted Ad5 vectors. The vaccine is constructed by the Admax system derived from Microbix Biosystem. In phase I clinical trials, RBD (S1 subunit receptor binding domain) and S protein neutralizing antibody increased by 4 times 14 days after immunization, reaching a peak on 28 days. CD4+T and CD8+T cells reached a peak 14 days after immunization. The existing Ad5 immune resistance partially limits the response of antibodies and T cells. This study will be further conducted in the 18-60 age group, receiving 1/3 of the study dose, and follow-up for 3-6 months after immunization.
DNA vaccine
The introduction of antigen-encoding DNA and adjuvants as vaccines is the most innovative vaccine method. The transfected cells stably express the transgenic protein, similar to live viruses. The antigen will be endocytosed by immature DC, and finally provide antigen to CD4 + T, CD8 + T cells (by MHC differentiation) To induce humoral and cellular immunity. Some specificities of the virus and the new coronavirus mutant are different from general vaccines and other vaccines. Therefore, it is worth noting the gene expression of the vaccine. Otherwise, the effectiveness and efficiency of the vaccine will be questioned.
Live attenuated vaccine
DelNS1-SARS-CoV2-RBD
Basic influenza vaccine, delete NS1 gene. Express SARS-CoV-2 RBD domain. Cultured in CEF and MDCK (canine kidney cells) cells. It is more immunogenic than wild-type influenza virus and can be administered by nasal spray.
The viral genome is susceptible to mutation, antigen transfer and drift can occur, and spread among the population. Mutations can vary depending on the environmental conditions and population density of the geographic area. After screening and comparing 7,500 samples of infected patients, scientists found 198 mutations, indicating the evolutionary mutation of the virus in the human host. These mutations may form different virus subtypes, which means that even after vaccine immunization, viral infections may occur. A certain amount of increment and strengthening is needed here.
Inactivated vaccines, adenovirus vector vaccines, recombinant protein vaccines, nucleic acid vaccines, attenuated influenza virus vector vaccines, etc. According to relevant information, there are dozens of new coronavirus vaccines in the world, and more varieties are being developed and upgraded. Including the United States, Britain, China, Russia, India and other countries, there are more R&D and production units.
AZ vaccine
Modena vaccine
Lianya Vaccine
High-end vaccine
Pfizer vaccine
Pfizer-BioNTech
A large study found that the vaccine developed by Pfizer and German biotechnology company BioNTech is 95% effective in preventing COVID-19.
The vaccine is divided into two doses, which are injected every three weeks.
This vaccine uses a molecule called mRNA as its basis. mRNA is a molecular cousin of DNA, which contains instructions to build specific proteins; in this case, the mRNA in the vaccine encodes the coronavirus spike protein, which is attached to the surface of the virus and used to infect human cells. Once the vaccine enters the human body, it will instruct the body's cells to make this protein, and the immune system will learn to recognize and attack it.
Moderna
The vaccine developed by the American biotechnology company Moderna and the National Institute of Allergy and Infectious Diseases (NIAID) is also based on mRNA and is estimated to be 94.5% effective in preventing COVID-19.
Like Pfizer's vaccine, this vaccine is divided into two doses, but injected every four weeks instead of three weeks. Another difference is that the Moderna vaccine can be stored at minus 20 degrees Celsius instead of deep freezing like Pfizer vaccine. At present, the importance of one of the widely used vaccines is self-evident.
Oxford-AstraZeneca
The vaccine developed by the University of Oxford and the pharmaceutical company AstraZeneca is approximately 70% effective in preventing COVID-19-that is, in clinical trials, adjusting the dose seems to improve this effect.
In the population who received two high-dose vaccines (28 days apart), the effectiveness of the vaccine was about 62%; according to early analysis, the effectiveness of the vaccine in those patients who received the half-dose first and then the full-dose Is 90%. However, in clinical trials, participants taking half doses of the drug are wrong, and some scientists question whether these early results are representative.
Sinopharm Group (Beijing Institute of Biological Products, China)
China National Pharmaceutical Group Sinopharm and Beijing Institute of Biological Products have developed a vaccine from inactivated coronavirus (SARS-CoV-2). The inactivated coronavirus is an improved version that cannot be replicated.
Estimates of the effectiveness of vaccines against COVID-19 vary.
Gamaleya Institute
The Gamaleya Institute of the Russian Ministry of Health has developed a coronavirus vaccine candidate called Sputnik V. This vaccine contains two common cold viruses, adenoviruses, which have been modified so that they will not replicate in the human body; the modified virus also contains a gene encoding the coronavirus spike protein.
New crown drugs
There are many small molecule antiviral drug candidates in the clinical research stage around the world. Including traditional drugs in the past and various drugs yet to be developed, antiviral drugs, immune drugs, Gene drugs, compound drugs, etc.
(A) Molnupiravir
Molnupiravir is a prodrug of the nucleoside analog N4-hydroxycytidine (NHC), jointly developed by Merck and Ridgeback Biotherapeutics.
The positive rate of infectious virus isolation and culture in nasopharyngeal swabs was 0% (0/47), while that of patients in the placebo group was 24% (6/25). However, data from the Phase II/III study indicate that the drug has no benefit in preventing death or shortening the length of stay in hospitalized patients.
Therefore, Merck has decided to fully advance the research of 800mg molnupiravir in the treatment of patients with mild to moderate COVID-19.
(B) AT-527
AT-527 is a small molecule inhibitor of viral RNA polymerase, jointly developed by Roche and Atea. Not only can it be used as an oral therapy to treat hospitalized COVID-19 patients, but it also has the potential as a preventive treatment after exposure.
Including 70 high-risk COVID-19 hospitalized patients data, of which 62 patients' data can be used for virological analysis and evaluation. The results of interim virological analysis show that AT-527 can quickly reduce viral load. On day 2, compared with placebo, patients treated with AT-527 had a greater decline in viral load than the baseline level, and the continuous difference in viral load decline was maintained until day 8.
In addition, compared with the control group, the potent antiviral activity of AT-527 was also observed in patients with a baseline median viral load higher than 5.26 log10. When testing by RT-qPCR to assess whether the virus is cleared,
The safety aspect is consistent with previous studies. AT-527 showed good safety and tolerability, and no new safety problems or risks were found. Of course, there is still a considerable distance between experiment and clinical application, and a large amount of experimental data can prove it.
(C) Prokrutamide
Prokalamide is an AR (androgen receptor) antagonist. Activated androgen receptor AR can induce the expression of transmembrane serine protease (TMPRSS2). TMPRSS2 has a shearing effect on the new coronavirus S protein and ACE2, which can promote the binding of viral spike protein (S protein) to ACE, thereby promoting The virus enters the host cell. Therefore, inhibiting the androgen receptor may inhibit the viral infection process, and AR antagonists are expected to become anti-coronavirus drugs.
Positive results were obtained in a randomized, double-blind, placebo-controlled phase III clinical trial. The data shows that Prokalutamide reduces the risk of death in severely ill patients with new coronary disease by 92%, reduces the risk of new ventilator use by 92%, and shortens the length of hospital stay by 9 days. This shows that procrulamide has a certain therapeutic effect for patients with severe new coronary disease, which can significantly reduce the mortality of patients, and at the same time greatly reduce the new mechanical ventilation and shorten the patient's hospital stay.
With the continuous development of COVID-19 on a global scale, in addition to vaccines and prevention and control measures, we need a multi-pronged plan to control this disease. Oral antiviral therapy undoubtedly provides a convenient treatment option.
In addition, there are other drugs under development and experimentation. In dealing with the plague virus, in addition to the strict control of protective measures, it is very important that various efficient and safe vaccines and various drugs (including medical instruments, etc.) are the ultimate nemesis and killer of the virus.
(A) "Antiviral biological missiles" are mainly drugs for new coronaviruses and mutant viruses, which act on respiratory and lung diseases. The drugs use redundant designs to inhibit new coronaviruses and variant viruses.
(B) "New Coronavirus Epidemic Prevention Tablets" mainly use natural purified elements and chemical structure modifications.
(C) "Composite antiviral oral liquid" antiviral intermediate, natural antiviral plant, plus other preparations
(D) "New Coronavirus Long-acting Oral Tablets" Chemical modification of antiviral drugs, multiple targets, etc.
(E) "New Coronavirus Inhibitors" (injections) are mainly made of chemical drug structure modification and other preparations.
The development of these drugs mainly includes: drug target screening, structure-activity relationship, chemical modification, natural purification, etc., which require a lot of work and experimentation.
Humans need to vigorously develop drugs to deal with various viruses. These drugs are very important for the prevention and treatment of viruses and respiratory infectious diseases, influenza, pneumonia, etc.
The history of human development The history of human evolution, like all living species, will always be accompanied by the survival and development of microorganisms. It is not surprising that viruses and infectious diseases are frequent and prone to occur. The key is to prevent and control them before they happen.
This strain was first discovered in India in October 2020 and was initially called a "double mutant" virus by the media. According to the announcement by the Ministry of Health of India at the end of March this year, the "India New Coronavirus Genomics Alliance" composed of 10 laboratories found in samples collected in Maharashtra that this new mutant strain carries E484Q and L452R mutations. , May lead to immune escape and increased infectivity. This mutant strain was named B.1.617 by the WHO and was named with the Greek letter δ (delta) on May 31.
Shahid Jamil, the dean of the Trivedi School of Biological Sciences at Ashoka University in India and a virologist, said in an interview with the Shillong Times of India that this mutant strain called "double mutation" is not accurate enough. B. 1.617 contains a total of 15 mutations, of which 6 occur on the spike protein, of which 3 are more critical: L452R and E484Q mutations occur on the spike protein and the human cell "Angiotensin Converting Enzyme 2 (ACE2)" receptor In the bound region, L452R improves the ability of the virus to invade cells, and E484Q helps to enhance the immune escape of the virus; the third mutation P681R can also make the virus enter the cell more effectively. (Encyclopedia website)
There are currently dozens of antiviral COVID-19 therapies under development. The large drugmakers Merck and Pfizer are the closest to the end, as expected, a pair of oral antiviral COVID-19 therapies are undergoing advanced human clinical trials.
Merck's drug candidate is called monupiravir. It was originally developed as an influenza antiviral drug several years ago. However, preclinical studies have shown that it has a good effect on SARS and MERS coronavirus.
Monupiravir is currently undergoing in-depth large-scale Phase 3 human trials. So far, the data is so promising that the US government recently pre-ordered 1.7 million courses of drugs at a cost of $1.2 billion. If everything goes according to plan, the company hopes that the drug will be authorized by the FDA for emergency use and be on the market before the end of 2021.
Pfizer's large COVID-19 antiviral drug candidate is more unique. Currently known as PF-07321332, this drug is the first oral antiviral drug to enter human clinical trials, specifically targeting SARS-CoV-2.
Variant of Concern WHO Label First Detected in World First Detected in Washington State
B.1.1.7 Alpha United Kingdom, September 2020 January 2021
B.1.351 Beta South Africa, December 2020 February 2021
P.1 Gamma Brazil, April 2020 March 2021
B.1.617.2 Delta India, October 2020 April 2021
Although this particular molecule was developed in 2020 after the emergence of the new coronavirus, a somewhat related drug called PF-00835231 has been in operation for several years, targeting the original SARS virus. However, the new drug candidate PF-07321332 is designed as a simple pill that can be taken under non-hospital conditions in the initial stages of SARS-CoV-2 infection.
"The protease inhibitor binds to a viral enzyme and prevents the virus from replicating in the cell," Pfizer said when explaining the mechanism of its new antiviral drug. "Protease inhibitors have been effective in the treatment of other viral pathogens, such as HIV and hepatitis C virus, whether used alone or in combination with other antiviral drugs. Currently marketed therapeutic drugs for viral proteases are generally not toxic Therefore, such molecules may provide well-tolerated treatments against COVID-19."
Various studies on other types of antiviral drugs are also gaining momentum. For example, the new coronavirus pneumonia "antiviral biological missile", "new coronavirus prevention tablets", "composite antiviral oral liquid", "new coronavirus long-acting oral tablets", "new coronavirus inhibitors" (injections), etc., are worthy of attention. Like all kinds of vaccines, they will play a major role in preventing and fighting epidemics.
In addition, Japanese pharmaceutical company Shionoyoshi Pharmaceutical is currently conducting a phase 1 trial of a protease inhibitor similar to SARS-CoV-2. This is called S-217622, which is another oral antiviral drug, and hopes to provide people with an easy-to-take pill in the early stages of COVID-19. At present, the research and development of vaccines and various new crown drugs is very active and urgent. Time does not wait. With the passage of time, various new crown drugs will appear on the stage one after another, bringing the gospel to the complete victory of mankind.
The COVID-19 pandemic is far from over. The Delta mutant strain has quickly become the most prominent SARS-CoV-2 strain in the world. Although our vaccine is still maintained, it is clear that we need more tools to combat this new type of coronavirus. Delta will certainly not be the last new SARS-CoV-2 variant we encountered. Therefore, it is necessary for all mankind to persevere and fight the epidemic together.
Overcome illness and meet new challenges. The new crown epidemic and various mutated viruses are very important global epidemic prevention and anti-epidemic top priorities, especially for the current period of time. Vaccine injections, research and development of new drugs, strict prevention and control, wear masks, reduce gatherings, strictly control large gatherings, prevent the spread of various viruses Masks, disinfection and sterilization, lockdown of the city, vaccinations, accounting and testing are very important, but this does not mean that humans can completely overcome the virus. In fact, many spreading and new latently transmitted infections are still unsuccessful. There are detections, such as invisible patients, asymptomatic patients, migratory latent patients, new-onset patients, etc. The struggle between humans and the virus is still very difficult and complicated, and long-term efforts and exploration are still needed, especially for medical research on the new coronavirus. The origin of the disease, the course of the disease, the virus invaded The deep-level path and the reasons for the evolution and mutation of the new coronavirus and the particularity of prevention and treatment, etc.). Therefore, human beings should be highly vigilant and must not be taken lightly. The fierce battle between humans and various viruses must not be slackened. Greater efforts are needed to successfully overcome this pandemic, fully restore the normal life of the whole society, restore the normal production and work order, restore the normal operation of society, economy and culture, and give up food due to choking. Or eager for success, will pay a high price.
———————————————————————————————————————————————— ————
References References are made to web resources, and related images are from web resources and related websites.
Who official website UN .org www.gavi.org/ispe.org
Wikipedia, "The Lancet", "English Journal of Medicine", "Nature", "Science", "Journal of the American Medical Association", etc.
Learning from history: do not flatten the curve of antiviral research!
T Bobrowski, CC Melo-Filho, D Korn, VM Alves...-Drug discovery today, 2020-
A critical overview of computational approaches employed for COVID-19 drug discovery
EN Muratov, R Amaro, CH Andrade, N Brown...-Chemical Society..., 2021-pubs.rsc.org
Global Research Performance on COVID 19 in Dimensions Database
J Balasubramani, M Anbalagan-2021-researchgate.net
Adoption of a contact tracing app for containing COVID-19: a health belief model approach
M Walrave, C Waeterloos...- JMIR public health and..., 2020-publichealth.jmir.org
Prophylactic Treatment Protocol Against the Severity of COVID-19 Using Melatonin
N Charaa, M Chahed, H Ghedira...-Available at SSRN..., 2020-papers.ssrn.com
Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China, The Lancet
Transmission of 2019-nCoV Infection from an Asymptomatic Contact in Germany, New England Journal of Medicine
The actions of respiratory therapists facing COVID-19
Zhu Jiacheng-Respiratory Therapy, 2021-pesquisa.bvsalud.org
Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study, The Lancet
Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus–Infected Pneumonia in Wuhan, China, JAMA, February 7
Epidemiologic and Clinical Characteristics of Novel Coronavirus Infections Involving 13 Patients Outside Wuhan, China, JAMA
Delta variant triggers new phase in the pandemic | Science
science.sciencemag.org›
COVID vaccines slash viral spread – but Delta is an unknown
www.nature.com ›articles
Novel coronavirus pneumonia during ophthalmic surgery management strategy and recommendations
YH HUANG, SS LI, X YAO, YR YANG, DH QIN…-jnewmed.com
Delta variant: What is happening with transmission, hospital ...
Risk of long QT syndrome in novel coronavirus COVID-19
VN Oslopov, JV Oslopova, EV Hazova…-Kazan medical…, 2020-kazanmedjournal.ru
Study compares mRNA and adenovirus-based SARS-CoV-2 vaccines ...
First molecular-based detection of SARS-CoV-2 virus in the field-collected houseflies
A Soltani, M Jamalidoust, A Hosseinpour, M Vahedi...-Scientific Reports, 2021-nature.com
Covid 19 DELTA Variant Archives-Online essay writing service
sourceessay.com ›tag› covid-19-delta-variant
SARS-CoV-2 Delta variant Likely to become dominant in the ...
Compilation postscript
Once Fang Ruida's research literature on the new crown virus and mutant virus was published, it has been enthusiastically praised by readers and netizens in dozens of countries around the world, and has proposed some amendments and suggestions. Hope to publish a multilingual version of the book as an emergency To meet the needs of many readers around the world, in the face of the new crown epidemic and the prevention and treatment of various mutant viruses, including the general public, college and middle school students, medical workers, medical colleagues and so on. According to the English original manuscript, it will be re-compiled and published. Inconsistencies will be revised separately. Thank you very much.
Jacques Lucy, Geneva, Switzerland, August 2021
*********************************************************************
Leader mondial, scientifique, scientifique médical, virologue, pharmacien et professeur Fangruida (F.D Smith) sur l'épidémie mondiale et l'ennemi juré et la prévention des nouveaux coronavirus et virus mutants (Jacques Lucy 2021v1.5)
_-----------------------------------------
L'ennemi juré et le tueur du nouveau coronavirus et des virus mutés - Développement conjoint de vaccins et de médicaments (Fangruida) Juillet 2021
* La particularité des nouveaux coronavirus et des virus mutants * Le large spectre, la haute efficacité, la redondance et la sécurité de la conception et du développement du nouveau vaccin contre le coronavirus, Redondance et sécurité
The Genetic Code: The colour wheel reveals RNA triplet codes for various amino acids, the links in the chain of protein molecules. For examples, the chain CAG demands the attachment of a glutamic acid link (top left). Notice how the code is redundant for most amino acids, preventing some form of protection against mutations.
This picture is taken from P.W. Atkins Galileo's Finger and further adapted at The Ribosome: BSBX2 2009, Practical 7, Structural Bioinformatics:
"Which amino acid that is going to be incorporated into the growing peptide chain is determined by the codon (a triplet of bases) on the mRNA (fig 2). Many amino acids have several codon options, so each amino acid can be incorporated by a set of different codons. For example, the amino acid lysine has two codons and serine has 6 different codons. Codons for the same amino acid tend to have the same nucleotides for the two first positions and only differ in the third position. Only two amino acids, tryptophan and methionine, have one single codon. The codon for methionine is also a start signal for protein synthesis. There are also several stop codons, which are used as a signal when the protein message is ending. These are decoded not by a tRNA but by a protein called release factor."
"The reading of the mRNA codon is performed by the three bases on the tRNA that makes up the so called anti-codon. If the pairing is correct, this amino acid will be incorporated into the growing peptide chain. Since most amino acids have several codons at their disposal, this must mean that either there must be many more tRNAs than is absolutely necessary, or that some tRNAs can base pair with more than one codon. In fact, both scenarios are true. Some amino acids do have more than one tRNA but. Also, while the first two base pairs strictly have to be correctly base paired, in the third so-called wobble position of the codon, some mismatches and non-standard base pairs are tolerated. This also explains why often different codons for the same amino acid have the same bases in the first two positions."
Mingle Media TV and Red Carpet Report host Paige Sullivan were invited to come back and cover the 2nd Annual Rebels with a Cause Gala at Paramount Studios honoring Larry Ellison with Jimmy Kimmel hosting and special guest performances by Barry Manilow and Pharrell Williams. This event supports the lifesaving research of David B. Agus, M.D. at USC’s Center for Applied Molecular Medicine.
Get the Story from the Red Carpet Report Team, follow us on Twitter and Facebook at:
www.facebook.com/RedCarpetReportTV
www.youtube.com/MingleMediaTVNetwork
ABOUT THE USC CENTER FOR APPLIED MOLECULAR MEDICINE
The principal goal of the USC Center for Applied Molecular Medicine is the development of novel treatment strategies for cancer. The Center was implemented to enable a convergence of multiple disciplines to work on treatment and the care of patients with cancer. The program includes the clinical care of patients with cancer at the USC Westside Cancer Center in Beverly Hills and has team members with expertise spanning cancer biology, biochemistry, molecular biology, bioinformatics, computer science, electrical engineering, bioorganic chemistry, physics and applied mathematics. For information, visit camm.usc.edu/.
For more of Mingle Media TV’s Red Carpet Report coverage, please visit our website and follow us on Twitter and Facebook here:
www.facebook.com/minglemediatvnetwork
www.flickr.com/MingleMediaTVNetwork
Follow our host Paige Sullivan on Twitter at twitter.com/PaigeSull
Visitors thread coloured beads according to sequence sections from a range of organisms including trout, chimpanzee, butterfly, a flesh- eating microbe and rotting corpse flower. Depending on their age and understanding, visitors can also thread a second strand with complementary base pairs.
(via www.sanger.ac.uk and www.ebi.ac.uk)
www.yourgenome.org/downloads/sequence_bracelet_inst_A4.pdf
Chimpanzee (Pan troglodytes) GTATTTGTGGTAAACCCAGTG Sequence taken from the gene that codes for granulysin. Granulysin is a toxic protein that is released by immune cells in response to infection to kill pathogens like bacteria.
Brown trout (Salmo trutta) TACATCAGCACTAACTCAAGG Sequence taken from trout mitochondrial DNA. Variation in this sequence can be used to trace trout populations and evolution. Mitochondria are small energy factories within eukaryotic cells that have their own genome of about 16,000 base pairs.
Human (Homo sapiens) TCTGAGTTCTTACTTCGAAGG Sequence taken from part of the OCA2 gene. The OCA2 gene codes for a protein involved in pigmentation and variation in its sequence is a major influence on whether the colour of our eyes is brown or blue.
Butterfly (Danaus plexippus) ATGATCCCGACTATTACTATG Sequence from a gene that codes for an ‘opsin’ protein. This particular opsin protein reacts to ultraviolet (UV) light, which the butterfly uses to navigate.
Malayan spitting cobra (Naja sputatrix) AACCGACCGCTGCAACAACTG Sequence from a gene that codes for a toxin protein. This toxin is a component of the cobra’s venom, and blocks signals between the nerve and muscle cells of the cobra’s prey, paralysing them.
Flesh-eating microbe (Mycoplasma alligatoris) CAACAGTGATTTAGGTTACAC Sequence taken from part of the gene that codes for an enzyme called sialidase. When these bacteria infect an alligator they secrete sialidase to break-down the alligator’s tissues, enabling them to spread through its body.
Sweet orange (Citrus sinensis) TGCTACAGTTGCTGTTGTTGG Sequence taken from the gene that codes for pectinesterase. Pectinesterase is an enzyme that helps to break down the cell walls of the orange when it ripens, making the flesh soft.
Carnivorous plant (Drosera rotundifolia) GTAGCCACAGACTCAGTCATC Sequence taken from part of a gene that codes for a chitinase enzyme. The plant secretes these enzymes to break down the chitin-rich body casing of any insect that gets trapped on its tentacles.
Giant Madagascar hissing cockroach (Gromphadorhina portentosa) GATTCGCCGCTATCAGAAGAG Sequence taken from the gene that codes for histone 3. Histone 3 is one of eight histone proteins that combine to form nucleosomes, the bundles around which DNA is wrapped in the nucleus.
Corpse flower (Amorphophallus titanium) TCGAACCCGTTGTTGGGGAGG This sequence is from the gene that codes for the enzyme ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO). This enzyme is involved in plant photosynthesis and respiration.
Mingle Media TV and Red Carpet Report host Paige Sullivan were invited to come back and cover the 2nd Annual Rebels with a Cause Gala at Paramount Studios honoring Larry Ellison with Jimmy Kimmel hosting and special guest performances by Barry Manilow and Pharrell Williams. This event supports the lifesaving research of David B. Agus, M.D. at USC’s Center for Applied Molecular Medicine.
Get the Story from the Red Carpet Report Team, follow us on Twitter and Facebook at:
www.facebook.com/RedCarpetReportTV
www.youtube.com/MingleMediaTVNetwork
ABOUT THE USC CENTER FOR APPLIED MOLECULAR MEDICINE
The principal goal of the USC Center for Applied Molecular Medicine is the development of novel treatment strategies for cancer. The Center was implemented to enable a convergence of multiple disciplines to work on treatment and the care of patients with cancer. The program includes the clinical care of patients with cancer at the USC Westside Cancer Center in Beverly Hills and has team members with expertise spanning cancer biology, biochemistry, molecular biology, bioinformatics, computer science, electrical engineering, bioorganic chemistry, physics and applied mathematics. For information, visit camm.usc.edu/.
For more of Mingle Media TV’s Red Carpet Report coverage, please visit our website and follow us on Twitter and Facebook here:
www.facebook.com/minglemediatvnetwork
www.flickr.com/MingleMediaTVNetwork
Follow our host Paige Sullivan on Twitter at twitter.com/PaigeSull
I'm running for the board of the H+ (formerly WTA), and I'm out stumping for a few votes. My candidacy statement is on the H+ website, but if you'd like to discuss any component of my vision don't hesitate to e mail or FlickrMail me.
www.transhumanism.org/index.php/WTA/more/hbrdc/
Elections start tomorrow, so if your membership has expired you'll need to renew today.
While all the candidates look great, I'm particularly excited about working with Sonia Arrison, George Dvorsky, Patri Friedman, Ben Goertzel, Stephane Gounari, Jonas Lamis, and Mike LaTorra.
My candidacy statement...
In my early teens I became conscious of the limits of the human condition and became increasingly interested in how humans could grow past those boundaries. One of the greatest joys I had was the discovery I wasn’t alone. Others also saw a future where we would be able to transcend the limitations of our current state of violence, disease and hate through a thoughtful but ambitious application of human effort. The WTA has been instrumental in providing a framework for making cognitive and moral decisions over the last decade of my life, and I’ve decided I’d like to carry the torch as a member of the WTA Board.
Over the last decade I’ve worked on a variety of projects to extend human capabilities, in both conventional science and in more forward leaning fields. In the conventional sciences I’ve worked with a number of cutting edge laboratories at UCLA, ASU and Texas A&M with degrees in Neuroscience and Bioinformatics. More related to the WTA I’m an active adviser to the Methuselah Foundation, worked with the cryonics organizations Alcor Life Extension Foundation and Suspended Animation, as well as a variety of other transhumanist projects. I am currently commercially developing interfaces for mobile computing as part of my lifelong fascination with wearable computers. I also spend considerable amounts of time cultivating memetic substrates, most notably with the BIL Conference (next occuring Feb 7-8, ‘09, www.BILconference.com) but in other less-anarchic technology conferences PodCampAz and GeekWeek.
Humanity needs a place where ideas of consequence can be subject to rational (and sometimes irrational) debate and dissemination. As a board member for the WTA I’ll foster a haven for curious minds by supporting efforts to bring our message to university environments, a place where learned debate is flagging. I also support efforts to maintain relevancy to the rest of humanity and improve accessibility by being mindful of language and brand identity. I’ll help evolve the WTA structure to keep pace with a rapidly changing world.