The cells shown here are fibroblasts, one of the most common cells in mammalian connective tissue. These particular cells were taken from a mouse. Scientists used them to test the power of a new microscopy technique that offers vivid views of the inside of a cell. The DNA within the nucleus (blue), mitochondria (green) and cellular skeleton (red) is clearly visible.

 

Credit: Dylan Burnette and Jennifer Lippincott-Schwartz, Eunice Kennedy Shriver National Institute of Child Health

and Human Development, National Institutes of Health

 

Life Magnified images: www.nigms.nih.gov/education/life-magnified/Pages/7_bottom...

 

A couple more illustrated spam headers for my Fresh Spam blog.

Mãng cầu Xiêm, còn gọi là mãng cầu gai, na Xiêm, na gai Mãng cầu xiêm có tên khoa học là Annona muricata thuộc họ thực vật Annonaceae. (Annona, phát xuất từ tên tại Haiti, anon, nghĩa là thu-hoạch của năm ‘muricata’ có nghĩa l à mặt bên ngoài sần lên, có những mũi nhọn).

 

Các tên thông thường: Soursop (Anh-Mỹ), Guanabana, Graviola, Brazilian Paw Paw, Corossolier (Pháp), Guanavana, Durian benggala Nangka londa.

thuộc loại tiểu mộc, có thể cao 6-8 m. Vỏ thân có nhiều lỗ nhỏ màu nâu. lá màu đậm có mùi thơm, không lông, xanh quanh năm. Hoa màu xanh, mọc ở thân. Quả mãng cầu xiêm to và có gai mềm. Thịt quả ngọt và hơi chua, hạt có màu nâu sậm. Cây mãng cầu xiêm sống ở những khu vực có độ ẩm cao và có mùa Đông không lạnh lắm, nhiệt độ dưới 5°C sẽ làm lá và các nhánh nhỏ hỏng và nhiệt độ dưới 3°C thì cây có thể chết. Cây mãng cầu xiêm được trồng làm cây ăn quả. Quả mãng cầu Xiêm nặng trung bình từ 1-2 kg có khi đến 2,5 kg, vỏ ngoài nhẵn chỉ phân biệt múi nọ với múi kia nhờ mỗi múi có một cái gai cong, mềm vì vậy còn có tên là mãng cầu gai.

Giới (regnum):

Plantae

 

(không phân hạng):Angiospermae

 

(không phân hạng)Magnoliidae

 

Bộ (ordo):

Magnoliales

 

Họ (familia):

Annonaceae

 

Chi (genus):

Annona

 

Loài (species):

A. muricata

 

Mãng cầu xiêm là một trái cây nhiệt đới rất thường gặp trong vùng Nam Mỹ và Đông Ấn (West Indies). Đây cũng là một trong những cây đầu tiên được đưa từ Mỹ châu về lục địa ‘Cựu Thế Giới’, và mãng cầu xiêm sau đó được trồng rộng rãi suốt từ khu vực Đông Nam Trung Hoa sang đến Úc và những vùng bình nguyên tại Đông và Tây Phi châu.

 

Đặc tính thực vật:

Mãng cầu xiêm thuộc loại tiểu mộc, có thể cao 6-8 m. Vỏ thân có nhiều lỗ nhỏ màu nâu. Lá hình trái xoan, thuôn thành ngọn giáo, mọc so le. Lá có mùi thơm. Phiến lá có 7-9 cặp gân phụ. Hoa mọc đơn độc ở thân hay nhánh già; hoa có 3 lá đài nhỏ màu xanh, 3 cánh ngoài màu xanh-vàng, và 3 cánh trong màu vàng. Nhị và nhụy hoa tạo thành 1 khối tròn, Trái thuộc loại trái mọng kép, lớn, hình trứng phình dài 20-25 cm, màu xanh lục hay vàng xanh, khi chín quá mức sẽ đổi sang vàng. Trái có thể kết tại nhiều vị trí khác nhau trên thân, cành hay nhánh con, và có thể cân nặng đến 5kg (15 lb). Vỏ rất mỏng, bên ngoài có những nốt phù thành những múi nhỏ nhọn hay cong, chứa nhiều hạt màu đen. Trái thường được thu hái lúc còn xanh, cứng và ăn ngon nhất vào lúc 4-5 ngày sau khi hái, lúc đó quả trở thành mềm vừa đủ để khi nhấn nhẹ ngón tay vào sẽ có một vết lõm. Phần thịt của tr ái màu trắng chia thành nhiều khối chứa hạt nhỏ.

 

Thành phần dinh dưỡng và hóa học:

 

100 gram phần thịt của trái mãng cầu xiêm, bỏ hạt, chứa:

- Calories 53.1-61.3

- Chất đạm 1 g

- Chất béo 0.97 g

- Chất sơ 0.79 g

- Calcium 10.3 mg

- Sắt 0.64 mg

- Magnesium 21 mg

- Phosphorus 27.7 mg

- Potassium 287 mg

- Sodium 14 mg

- Beta-Carotene (A) 2 IU

- Thiamine 0.110 mg

- Riboflavine 0.050 mg

- Niacin 1.280 mg

- Pantothenic acid 0.253 mg

- Pyridoxine 0.059 mg

- Vitamin C 29.6 mg

 

Lá mãng cầu xiêm chứa các acetogenins loại monotetrahydrofurane như annopentocins A, B và C; Cis và Trans-annomuricin-D-ones(4, 5), Muricoreacin, Muricohexocin… ngoài ra còn có tannin, chất nhựa resin.

 

Trái mãng cầu xiêm chứa các alkaloids loại isoquinoleine như: annonaine, nornuciferine và asimilobine.

 

Hạt chứa khoảng 0.05 % alcaloids trong đó 2 chất chính là muricin và muricinin. Nghiên cứu tại ĐH Bắc Kinh (2001) ghi nhận hạt có chứa các acetogenins: Muricatenol, Gigantetrocin-A, -B, Annomontacin, Gigante tronenin. Trong hạt còn có các hỗn hợp N-fatty acyl tryptamines, một lectin có ái lực mạnh với glucose/mannose; các galactomannans..

 

Vài phương thức sử dụng:

 

Mãng cầu xiêm được dùng làm thực phẩm tại nhiều nơi trên thế giới. Tên soursop, cho thấy quả có thể có vị chua, tuy nhiên độ chua thay đổi, tùy giống, có giống khá ngọt để ăn sống được, có giống phải ăn chung với đường. Trái chứa nhiều nước, nên thường dùng để uống hơn là ăn! Như tại Ba Tây có món Champola, tại Puerto Rico có món Carato là những thức uống theo kiểu ‘nuớc sinh tố’ ở Việt Nam: mãng cầu xay chung với sữa, nước (tại Philippines, còn pha thêm màu xanh, đỏ như sinh tố pha si-rô ở Việt Nam)

 

Mãng cầu xiêm (lá, rễ và hạt) được dùng làm thuốc tại rất nhiều nơi trên thế-giới, nhất là tại những quốc gia Nam Mỹ:

 

Tại Peru, trong vùng núi Andes, lá mãng cầu được dùng làm thuốc trị cảm, xổ mũi; hạt nghiền nát làm thuốc trừ sâu bọ; trong vùng Amazon, vỏ cây và lá dùng trị tiểu đường, làm dịu đau, chống co giật.

 

Tại Guyana: lá và vỏ cây, nấu thành trà dược giúp trị đau và bổ tim.

 

Tại Ba Tây, trong vùng Amazon: lá nấu thành trà trị bệnh gan; dầu ép từ lá và trái còn non, trộn với dầu olive làm thuốc thoa bên ngoài trị thấp khớp, đau sưng gân cốt.

 

Tại Jamaica, Haiti và West Indies: trái hay nước ép từ trái dùng trị nóng sốt, giúp sinh sữa và trị tiêu chảy; vỏ thân cây và lá dùng trị đau nhức, chống co-giật, ho, suyển.

 

Tại Ấn Độ, cây được gọi theo tiếng Tamilnadu là mullu-chitta: quả dùng chống thiếu vitamin C ( scorbut); hạt gây nôn mửa và làm se da.

 

Tại Việt Nam, hạt được dùng như hạt na, nghiền nát trong nước, lấy nước gột đầu để trị chí rận. Một phương thuốc Nam khá phổ biến để trị huyết áp cao là dùng vỏ trái hay lá mãng cầu xiêm, sắc chung với rễ nhàu và rau cần thành nước uống (bỏ bã) mỗi ngày.

Dược tính của mãng cầu xiêm:

 

Các nhà khoa học đã nghiên cứu về dược tính của mãng cầu xiêm từ 1940 và ly trích được nhiều hoạt chất. Một số các nghiên cứu sơ khởi được công bố trong khoảng thời gian 1940 đến 1962 ghi nhận vỏ thân và lá mãng cầu xiêm có những tác dụng làm hạ huyết áp, chống co giật, làm giãn nở mạch máu, thư giãn cơ trơn khi thử trên thú vật. Đến 1991, tác dụng hạ huyết áp của lá mãng cầu xiêm đã được tái xác nhận. Các nghiên cứu sau đó đã chứng minh được là dịch chiết từ lá, vỏ thân, rễ, chồi và hạt mãng cầu xiêm có những tác dụng kháng sinh chống lại một số vi khuẩn gây bệnh, và vỏ cây có khả năng chống nấm.

 

Hoạt tính của các acetogenins:

 

Trong một chương trình nghiên cứu về dược thảo của National Cancer Institute vào năm 1976, lá và chồi của mãng cầu xiêm được ghi nhận là có hoạt tính diệt các tế bào của một số loại ung thư. Hoạt tính này được cho là do ở nhóm hợp chất, đặt tên là annonaceous acetogenins

 

Các nghiên cứu về acetogenins cho thấy những chất này có khả năng ức chế rất mạnh phức hợp I (Complex I) ở trong các hệ thống chuyển vận điện tử nơi ty lạp thể (mitochondria) kể cả của tế bào ung thư [ các cây của gia đình Anonna có chứa nhiều loại acetogenins hoạt tính rất mạnh, một số có tác dụng diệt tế bào u-bướu ở nồng độ EC50 rất thấp, ngay ở 10-9 microgram/ mL.]

 

Trường Đại Học Purdue là nơi có nhiều nghiên cứu nhất về hoạt tính của gia đình Annona, giữ hàng chục bản quyền về acetogenins, và công bố khá nhiều thí nghiệm lâm sàng về tác dụng của acetogenins trên ung thư, diệt bướu ung độc:

 

Một nghiên cứu năm 1998 ghi nhận một loại acetogenin trích từ mãng cầu xiêm có tác dụng chọn lựa, diệt được tế bào ung thư ruột già loại adenocarcinoma, tác dụng này mạnh gấp 10 ngàn lần thuốc Adriamycin.

Theo các kết quả nghiên cứu tại Purdue thì: ‘các acetogenins từ annonaceae, là những acid béo có dây carbon dài từ 32-34, phối hợp với một đơn vị 2-propanol tại C-2 để tạo thành một vòng lactone. Acetogenins có những hoạt tính sinh học như chống u-bướu, kích ứng miễn nhiễm, diệt sâu bọ, chống protozoa, diệt giun sán và kháng sinh. Acetogenins là những chất ức chế rất mạnh NADH:Ubiquinone oxidoreductase, vốn là một enzym căn bản cần thiết cho complex I đưa đến phàn ứng phosphoryl-oxid hóa trong mitochondria. Acetogenins tác dụng trực tiếp vào các vị trí ubiquinone-catalytic nằm trong complex I và ngay vào men glucose dehydrogenase của vi trùng. Acetogenins cũng ức chế men ubiquinone-kết với NADH oxidase, chỉ có nơi màng plasma của tế bào ung thư.(Recent Advances in Annonaceous Acetogenins-Purdue University -1997)

 

Các acetogenins Muricoreacin và Muricohexocin có những hoạt tính diệt bào khá mạnh trên 6 loại tế bào ung thư như ung thư tiền liệt tuyền (prostate) loại adenocarcinoma (PC-3), ung thư lá lách loại carcinoma (PACA-2) (ĐH Purdue, West LaFayette, IN- trong Phytochemistry Số 49-1998)

 

Một acetogenin khác :Bullatacin có khả năng diệt được các tế bào ung thư đã kháng được nhiều thuốc dùng trong hóa-chất trị liệu, do ở hoạt tính ngăn chận sự chế tạo Adenosine triphosphate (ATP) cần thiết cho hoạt động của tế bào ung thư (Cancer Letter June 1997)

 

Các acetogenins trích từ lá Annomutacin, cùng các hợp chất loại annonacin-A-one có hoạt tính diệt được tế bào ung thư phổi dòng A-549 (Journal of Natural Products Số Tháng 9-1995)

 

Các duợc tính khác:

 

Các alkaloid: annonaine, nornuciferine và asimilobine trích được từ trái có tác dụng an thần và trị đau: Hoạt tính này do ở khả năng ức chế sự nối kết của [3H] rauwolscine vào các thụ thể 5-HT1A nằm trong phần yên của não bộ. (Journal of Pharmacy and Pharmacology Số 49-1997).

 

Dịch chiết từ trái bằng ethanol có tác dụng ức chế được siêu vi khuẩn Herpes Simplex (HSV-1) ở nồng độ 1mg/ml (Journal of Ethnophar macology Số 61-1998).

 

Các dịch chiết bằng hexane, ethyl acetate và methanol từ trái đều có những hoạt tính diệt được ký sinh trùng Leishmania braziliensis và L.panamensis (tác dụng này còn mạnh hơn cả chất Glucantime dùng làm tiêu chuẩn đối chiếu). Ngoài ra các acetogenins cô lập được annonacein, annonacin A và annomuricin A có các hoạt tính gây độc hại cho các tế bào ung thư dòng U-937 (Fitotherapia Số 71-2000).

 

Thử nghiệm tại Đại học Universidade Federal de Alagoas, Maceio-AL, Ba Tây ghi nhận dịch chiết từ lá bằng ethanol có khả năng diệt được nhuyến thể (ốc-sò) loài Biomphalaria glabrata ở nồng độ LD50 = 8.75 ppm, và có thêm đặc điểm là diệt được các tụ khối trứng của sên (Phytomedicine Số 8-2001).

 

Một lectin loại glycoproteine chứa 8% carbohydrate, ly trích từ hạt có hoạt tính kết tụ hồng huyết cầu của người, ngỗng, ngựa và gà, đồng thời ức chế được sự tăng trưởng của các nấm và mốc loại Fusarium oxysoporum, Fusarium solani và Colletotrichum musae (Journal of Protein Chemistry Số 22-2003)

 

Mãng cầu xiêm có liên hệ với bệnh Parkinson:

 

Tại vùng West Indies thuộc Pháp, nhất là ở Guadaloupe có tình trạng xảy ra bất thường về con số các bệnh nhân bị bệnh Parkinson, loại kháng-levo dopa: những bệnh nhân này đều tiêu thụ một lượng cao, và trong một thời gian lâu dài soursop hay mãng cầu xiêm (A.muricata).

 

Những nghiên cứu sơ khởi trong năm 1999 (công bố trên tạp chí Lancet Số 354, ngày 23 tháng 10 năm 1999) trên 87 bệnh nhân đưa đến kết luận là rất có thể có sự liên hệ giữa dùng nhiều mãng cầu xiêm, vốn có chứa các alkaloids loại benzyltetrahydroisoquinoleine độc hại về thần kinh. Nhóm bệnh nhân có những triệu chứng Parkinson không chuyên biệt (atipycal), gồm 30 người dùng khá nhiều mãng cầu trong cách ăn uống hàng ngày.

 

Nghiên cứu sâu rộng hơn vào năm 2002, cũng tại Guadeloupe, nhằm vào nhóm bệnh nhân Parkinson (atypical) cho thấy khi tách riêng các tế bào thần kinh (neuron) loại mesencephalic dopaminergic và cấy trong môi trường có chứa dịch chiết toàn phần rễ mãng cầu xiêm, hoặc chứa các hoạt chất cô lập như coreximinine, reticuline, có các kết quả như sau: Sau 24 giờ tiếp xúc: 50% các tế bào thần kinh cấy bị suy thoái ở nồng độ 18 microg/ml dịch chiết toàn phần; 4.3 microg/ml coreximine và 100 microg/ml reticuline.

 

Nghiên cứu này đưa đến kết luận là những alkaloids trích từ mãng cầu xiêm có thể có tác dụng điều hợp chức năng cùng sự thay đổi để sinh tồn của các tế bào thần kinh dopaminergic trong các thử nghiệm ‘in vitro’; và rất có thể có những liên hệ tác hại giữa việc dùng mãng cầu xiêm ở lượng cao và liên tục với những suy thoái về tế bào thần kinh. Do đó bệnh nhân Parkinson, do yếu tố an toàn nên tránh ăn mãng cầu xiêm! (Movement Disorders Số 17-2002).

 

Độc tính và liều lượng:

 

Theo tài liệu của Herbal Secrets of the Rain Forest:

Liều trị liệu của lá (cũng chứa lượng acetrogenins khá cao, so với rễ và hạt) là 2-3 gram chia làm 3-4 lần/ngày. Trên thị trường Hoa Kỳ có một số chế phẩm, mang tên Graviola, dưới các dạng viên nang (capsule) và cồn thuốc (tincture).

  

Không nên dùng các chế phẩm làm từ lá, rễ và hạt mãng cầu xiêm (phần thịt của quả không bị hạn chế) trong các trường hợp:

 

- Có thai: do hoạt tính gây co tht tử cung khi thử trên chuột.

- Huyết áp cao: Lá, rễ và ht có tác dụng gây hạ huyết áp, ức chế tim, người dùng thuốc trị áp huyết cần bàn với BS điều trị.

- Khi dùng lâu dài các chế phẩ;m Graviola có thể gây các rối loạn về vi sinh vật trong đường ruột.

- Một số trường h&##7907;p bị ói mửa, buồn nôn khi dùng Graviola, trong trường hợp này nên giảm bớt liều sử dụng.

- Không nên dùng Graviola chung với CoEnzyme Q 10 (một trong những cơ chế hoạt động của acetogenins là ngăn chặn sự cung cấp ATP cho tế bào ung thư, và CoEnzym Q.10 là một chất cung cấp ATP), uống chung sẽ làm giảm công hiệu của cả 2 loại.

   

Annona muricata is a member of the family of Custard apple trees called Annonaceae and a species of the genus Annona known mostly for its edible fruits Anona. Annona muricata produces fruits that are usually called Soursop due to its slightly acidic taste when ripe. A. muricata trees grew natively in the Caribbean and Central America but are now widely cultivated and in some areas, escaping and living on their own in tropical climates throughout the world.

Common names

•English: Brazilian pawpaw, soursop, prickly custard apple, Soursapi

•Spanish: guanábana, guanábano, anona, catche, catoche, catuche, zapote agrio

•Chamorro: laguaná, laguana, laguanaha, syasyap

•German: Sauersack, Stachelannone, anona, flashendaum, stachel anone, stachliger

•Fijian: sarifa, seremaia

•French: anone muriquee, cachiman épineux, corossol épineux,anone, cachiman épineux, caichemantier, coeur de boeuf, corossol, corossolier, epineux

•Indonesian: sirsak

•Malay: Durian Belanda

•Māori: kātara‘apa, kātara‘apa papa‘ā, naponapo taratara

•Dutch: zuurzak

•Portuguese: graviola, araticum-grande, araticum-manso, coração-de-rainha, jaca-de-pobre, jaca-do-Pará, anona, curassol, graviola, pinha azeda

•Samoan: sanalapa, sasalapa, sasalapa

•Tahitian: tapotapo papa‘a, tapotapo urupe

•Vietnamese: mãng cầu Xiêm, mãng cầu gai

•Chinese: 刺果番荔枝

Description

Annona muricata is a small, upright, evergreen that can grow to about 4 metres (13 ft) tall and cannot stand frost.

Stems and leaves

The young branches are hairy.

Leaves are oblong to oval, 8 centimetres (3.1 in) to 16 centimetres (6.3 in) long and 3 centimetres (1.2 in) to 7 centimetres (2.8 in) wide. Glossy dark green with no hairs above, paler and minutely hairy to no hairs below.

The leaf stalks are 4 millimetres (0.16 in) to 13 millimetres (0.51 in) long and without hairs.

Flowers

Flower stalks (peduncles) are 2 millimetres (0.079 in) to 5 millimetres (0.20 in) long and woody. They appear opposite from the leaves or as an extra from near the leaf stalk, each with one or two flowers, occasionally a third.

Stalks for the individual flowers (pedicels) are stout and woody, minutely hairy to hairless and 15 millimetres (0.59 in) to 20 millimetres (0.79 in) with small bractlets nearer to the base which are densely hairy.

Petals are thick and yellowish. Outer petals meet at the edges without overlapping and are broadly ovate, 2.8 centimetres (1.1 in) to 3.3 centimetres (1.3 in) by 2.1 centimetres (0.83 in) to 2.5 centimetres (0.98 in), tapering to a point with a heart shaped base. Evenly thick, covered with long, slender, soft hairs externally and matted finely with soft hairs within. Inner petals are oval shaped and overlap. 2.5 centimetres (0.98 in) to 2.8 centimetres (1.1 in) by 2 centimetres (0.79 in). Sharply angled and tapering at the base. Margins are comparatively thin, with fine matted soft hairs on both sides. The receptacle is conical and hairy. Stamens 4.5 millimetres (0.18 in) long and narrowly wedge-shaped. The connective-tip terminate abruptly and anther hollows are unequal. Sepals are quite thick and do not overlap. Carpels are linear and basally growing from one base. The ovaries are covered with dense reddish brown hairs, 1-ovuled, style short and stigma truncate.

Fruits and reproduction

Dark green, prickly (or bristled) fruits are egg-shaped and can be up to 30 centimetres (12 in) long, with a moderately firm texture.[5] Flesh is juicy, acid, whitish and aromatic.

Abundant seeds the average weight of 1000 fresh seeds is 470 grams (17 oz) and had an average oil content of 24%. When dried for 3 days in 60 °C (140 °F) the average seed weight was 322 grams (11.4 oz) and were tolerant of the moisture extraction; showing no problems for long-term storage under reasonable conditions.

Distribution

Annona muricata is tolerant of poor soil and prefers lowland areas between the altitudes of 0 metres (0 ft) to 1,200 metres (3,900 ft).

Native

Neotropic:

Caribbean: Cuba, Jamaica, Trinidad and Tobago, Haiti, Puerto Rico

Central America: Costa Rica, El Salvador, Guatemala, Honduras, Mexico, Nicaragua, Panama, Belize

South America: Bolivia, Colombia, Venezuela, Ecuador[4

  

A fungus (pl.: fungi or funguses) is any member of the group of eukaryotic organisms that includes microorganisms such as yeasts and molds, as well as the more familiar mushrooms. These organisms are classified as one of the traditional eukaryotic kingdoms, along with Animalia, Plantae and either Protista or Protozoa and Chromista.

 

A characteristic that places fungi in a different kingdom from plants, bacteria, and some protists is chitin in their cell walls. Fungi, like animals, are heterotrophs; they acquire their food by absorbing dissolved molecules, typically by secreting digestive enzymes into their environment. Fungi do not photosynthesize. Growth is their means of mobility, except for spores (a few of which are flagellated), which may travel through the air or water. Fungi are the principal decomposers in ecological systems. These and other differences place fungi in a single group of related organisms, named the Eumycota (true fungi or Eumycetes), that share a common ancestor (i.e. they form a monophyletic group), an interpretation that is also strongly supported by molecular phylogenetics. This fungal group is distinct from the structurally similar myxomycetes (slime molds) and oomycetes (water molds). The discipline of biology devoted to the study of fungi is known as mycology (from the Greek μύκης mykes, mushroom). In the past mycology was regarded as a branch of botany, although it is now known that fungi are genetically more closely related to animals than to plants.

 

Abundant worldwide, most fungi are inconspicuous because of the small size of their structures, and their cryptic lifestyles in soil or on dead matter. Fungi include symbionts of plants, animals, or other fungi and also parasites. They may become noticeable when fruiting, either as mushrooms or as molds. Fungi perform an essential role in the decomposition of organic matter and have fundamental roles in nutrient cycling and exchange in the environment. They have long been used as a direct source of human food, in the form of mushrooms and truffles; as a leavening agent for bread; and in the fermentation of various food products, such as wine, beer, and soy sauce. Since the 1940s, fungi have been used for the production of antibiotics, and, more recently, various enzymes produced by fungi are used industrially and in detergents. Fungi are also used as biological pesticides to control weeds, plant diseases, and insect pests. Many species produce bioactive compounds called mycotoxins, such as alkaloids and polyketides, that are toxic to animals, including humans. The fruiting structures of a few species contain psychotropic compounds and are consumed recreationally or in traditional spiritual ceremonies. Fungi can break down manufactured materials and buildings, and become significant pathogens of humans and other animals. Losses of crops due to fungal diseases (e.g., rice blast disease) or food spoilage can have a large impact on human food supplies and local economies.

 

The fungus kingdom encompasses an enormous diversity of taxa with varied ecologies, life cycle strategies, and morphologies ranging from unicellular aquatic chytrids to large mushrooms. However, little is known of the true biodiversity of the fungus kingdom, which has been estimated at 2.2 million to 3.8 million species. Of these, only about 148,000 have been described, with over 8,000 species known to be detrimental to plants and at least 300 that can be pathogenic to humans. Ever since the pioneering 18th and 19th century taxonomical works of Carl Linnaeus, Christiaan Hendrik Persoon, and Elias Magnus Fries, fungi have been classified according to their morphology (e.g., characteristics such as spore color or microscopic features) or physiology. Advances in molecular genetics have opened the way for DNA analysis to be incorporated into taxonomy, which has sometimes challenged the historical groupings based on morphology and other traits. Phylogenetic studies published in the first decade of the 21st century have helped reshape the classification within the fungi kingdom, which is divided into one subkingdom, seven phyla, and ten subphyla.

 

Etymology

The English word fungus is directly adopted from the Latin fungus (mushroom), used in the writings of Horace and Pliny. This in turn is derived from the Greek word sphongos (σφόγγος 'sponge'), which refers to the macroscopic structures and morphology of mushrooms and molds; the root is also used in other languages, such as the German Schwamm ('sponge') and Schimmel ('mold').

 

The word mycology is derived from the Greek mykes (μύκης 'mushroom') and logos (λόγος 'discourse'). It denotes the scientific study of fungi. The Latin adjectival form of "mycology" (mycologicæ) appeared as early as 1796 in a book on the subject by Christiaan Hendrik Persoon. The word appeared in English as early as 1824 in a book by Robert Kaye Greville. In 1836 the English naturalist Miles Joseph Berkeley's publication The English Flora of Sir James Edward Smith, Vol. 5. also refers to mycology as the study of fungi.

 

A group of all the fungi present in a particular region is known as mycobiota (plural noun, no singular). The term mycota is often used for this purpose, but many authors use it as a synonym of Fungi. The word funga has been proposed as a less ambiguous term morphologically similar to fauna and flora. The Species Survival Commission (SSC) of the International Union for Conservation of Nature (IUCN) in August 2021 asked that the phrase fauna and flora be replaced by fauna, flora, and funga.

 

Characteristics

 

Fungal hyphae cells

Hyphal wall

Septum

Mitochondrion

Vacuole

Ergosterol crystal

Ribosome

Nucleus

Endoplasmic reticulum

Lipid body

Plasma membrane

Spitzenkörper

Golgi apparatus

 

Fungal cell cycle showing Dikaryons typical of Higher Fungi

Before the introduction of molecular methods for phylogenetic analysis, taxonomists considered fungi to be members of the plant kingdom because of similarities in lifestyle: both fungi and plants are mainly immobile, and have similarities in general morphology and growth habitat. Although inaccurate, the common misconception that fungi are plants persists among the general public due to their historical classification, as well as several similarities. Like plants, fungi often grow in soil and, in the case of mushrooms, form conspicuous fruit bodies, which sometimes resemble plants such as mosses. The fungi are now considered a separate kingdom, distinct from both plants and animals, from which they appear to have diverged around one billion years ago (around the start of the Neoproterozoic Era). Some morphological, biochemical, and genetic features are shared with other organisms, while others are unique to the fungi, clearly separating them from the other kingdoms:

 

With other eukaryotes: Fungal cells contain membrane-bound nuclei with chromosomes that contain DNA with noncoding regions called introns and coding regions called exons. Fungi have membrane-bound cytoplasmic organelles such as mitochondria, sterol-containing membranes, and ribosomes of the 80S type. They have a characteristic range of soluble carbohydrates and storage compounds, including sugar alcohols (e.g., mannitol), disaccharides, (e.g., trehalose), and polysaccharides (e.g., glycogen, which is also found in animals).

With animals: Fungi lack chloroplasts and are heterotrophic organisms and so require preformed organic compounds as energy sources.

With plants: Fungi have a cell wall and vacuoles. They reproduce by both sexual and asexual means, and like basal plant groups (such as ferns and mosses) produce spores. Similar to mosses and algae, fungi typically have haploid nuclei.

With euglenoids and bacteria: Higher fungi, euglenoids, and some bacteria produce the amino acid L-lysine in specific biosynthesis steps, called the α-aminoadipate pathway.

The cells of most fungi grow as tubular, elongated, and thread-like (filamentous) structures called hyphae, which may contain multiple nuclei and extend by growing at their tips. Each tip contains a set of aggregated vesicles—cellular structures consisting of proteins, lipids, and other organic molecules—called the Spitzenkörper. Both fungi and oomycetes grow as filamentous hyphal cells. In contrast, similar-looking organisms, such as filamentous green algae, grow by repeated cell division within a chain of cells. There are also single-celled fungi (yeasts) that do not form hyphae, and some fungi have both hyphal and yeast forms.

In common with some plant and animal species, more than one hundred fungal species display bioluminescence.

Unique features:

 

Some species grow as unicellular yeasts that reproduce by budding or fission. Dimorphic fungi can switch between a yeast phase and a hyphal phase in response to environmental conditions.

The fungal cell wall is made of a chitin-glucan complex; while glucans are also found in plants and chitin in the exoskeleton of arthropods, fungi are the only organisms that combine these two structural molecules in their cell wall. Unlike those of plants and oomycetes, fungal cell walls do not contain cellulose.

A whitish fan or funnel-shaped mushroom growing at the base of a tree.

Omphalotus nidiformis, a bioluminescent mushroom

Most fungi lack an efficient system for the long-distance transport of water and nutrients, such as the xylem and phloem in many plants. To overcome this limitation, some fungi, such as Armillaria, form rhizomorphs, which resemble and perform functions similar to the roots of plants. As eukaryotes, fungi possess a biosynthetic pathway for producing terpenes that uses mevalonic acid and pyrophosphate as chemical building blocks. Plants and some other organisms have an additional terpene biosynthesis pathway in their chloroplasts, a structure that fungi and animals do not have. Fungi produce several secondary metabolites that are similar or identical in structure to those made by plants. Many of the plant and fungal enzymes that make these compounds differ from each other in sequence and other characteristics, which indicates separate origins and convergent evolution of these enzymes in the fungi and plants.

 

Diversity

Fungi have a worldwide distribution, and grow in a wide range of habitats, including extreme environments such as deserts or areas with high salt concentrations or ionizing radiation, as well as in deep sea sediments. Some can survive the intense UV and cosmic radiation encountered during space travel. Most grow in terrestrial environments, though several species live partly or solely in aquatic habitats, such as the chytrid fungi Batrachochytrium dendrobatidis and B. salamandrivorans, parasites that have been responsible for a worldwide decline in amphibian populations. These organisms spend part of their life cycle as a motile zoospore, enabling them to propel itself through water and enter their amphibian host. Other examples of aquatic fungi include those living in hydrothermal areas of the ocean.

 

As of 2020, around 148,000 species of fungi have been described by taxonomists, but the global biodiversity of the fungus kingdom is not fully understood. A 2017 estimate suggests there may be between 2.2 and 3.8 million species The number of new fungi species discovered yearly has increased from 1,000 to 1,500 per year about 10 years ago, to about 2000 with a peak of more than 2,500 species in 2016. In the year 2019, 1882 new species of fungi were described, and it was estimated that more than 90% of fungi remain unknown The following year, 2905 new species were described—the highest annual record of new fungus names. In mycology, species have historically been distinguished by a variety of methods and concepts. Classification based on morphological characteristics, such as the size and shape of spores or fruiting structures, has traditionally dominated fungal taxonomy. Species may also be distinguished by their biochemical and physiological characteristics, such as their ability to metabolize certain biochemicals, or their reaction to chemical tests. The biological species concept discriminates species based on their ability to mate. The application of molecular tools, such as DNA sequencing and phylogenetic analysis, to study diversity has greatly enhanced the resolution and added robustness to estimates of genetic diversity within various taxonomic groups.

 

Mycology

Mycology is the branch of biology concerned with the systematic study of fungi, including their genetic and biochemical properties, their taxonomy, and their use to humans as a source of medicine, food, and psychotropic substances consumed for religious purposes, as well as their dangers, such as poisoning or infection. The field of phytopathology, the study of plant diseases, is closely related because many plant pathogens are fungi.

 

The use of fungi by humans dates back to prehistory; Ötzi the Iceman, a well-preserved mummy of a 5,300-year-old Neolithic man found frozen in the Austrian Alps, carried two species of polypore mushrooms that may have been used as tinder (Fomes fomentarius), or for medicinal purposes (Piptoporus betulinus). Ancient peoples have used fungi as food sources—often unknowingly—for millennia, in the preparation of leavened bread and fermented juices. Some of the oldest written records contain references to the destruction of crops that were probably caused by pathogenic fungi.

 

History

Mycology became a systematic science after the development of the microscope in the 17th century. Although fungal spores were first observed by Giambattista della Porta in 1588, the seminal work in the development of mycology is considered to be the publication of Pier Antonio Micheli's 1729 work Nova plantarum genera. Micheli not only observed spores but also showed that, under the proper conditions, they could be induced into growing into the same species of fungi from which they originated. Extending the use of the binomial system of nomenclature introduced by Carl Linnaeus in his Species plantarum (1753), the Dutch Christiaan Hendrik Persoon (1761–1836) established the first classification of mushrooms with such skill as to be considered a founder of modern mycology. Later, Elias Magnus Fries (1794–1878) further elaborated the classification of fungi, using spore color and microscopic characteristics, methods still used by taxonomists today. Other notable early contributors to mycology in the 17th–19th and early 20th centuries include Miles Joseph Berkeley, August Carl Joseph Corda, Anton de Bary, the brothers Louis René and Charles Tulasne, Arthur H. R. Buller, Curtis G. Lloyd, and Pier Andrea Saccardo. In the 20th and 21st centuries, advances in biochemistry, genetics, molecular biology, biotechnology, DNA sequencing and phylogenetic analysis has provided new insights into fungal relationships and biodiversity, and has challenged traditional morphology-based groupings in fungal taxonomy.

 

Morphology

Microscopic structures

Monochrome micrograph showing Penicillium hyphae as long, transparent, tube-like structures a few micrometres across. Conidiophores branch out laterally from the hyphae, terminating in bundles of phialides on which spherical condidiophores are arranged like beads on a string. Septa are faintly visible as dark lines crossing the hyphae.

An environmental isolate of Penicillium

Hypha

Conidiophore

Phialide

Conidia

Septa

Most fungi grow as hyphae, which are cylindrical, thread-like structures 2–10 µm in diameter and up to several centimeters in length. Hyphae grow at their tips (apices); new hyphae are typically formed by emergence of new tips along existing hyphae by a process called branching, or occasionally growing hyphal tips fork, giving rise to two parallel-growing hyphae. Hyphae also sometimes fuse when they come into contact, a process called hyphal fusion (or anastomosis). These growth processes lead to the development of a mycelium, an interconnected network of hyphae. Hyphae can be either septate or coenocytic. Septate hyphae are divided into compartments separated by cross walls (internal cell walls, called septa, that are formed at right angles to the cell wall giving the hypha its shape), with each compartment containing one or more nuclei; coenocytic hyphae are not compartmentalized. Septa have pores that allow cytoplasm, organelles, and sometimes nuclei to pass through; an example is the dolipore septum in fungi of the phylum Basidiomycota. Coenocytic hyphae are in essence multinucleate supercells.

 

Many species have developed specialized hyphal structures for nutrient uptake from living hosts; examples include haustoria in plant-parasitic species of most fungal phyla,[63] and arbuscules of several mycorrhizal fungi, which penetrate into the host cells to consume nutrients.

 

Although fungi are opisthokonts—a grouping of evolutionarily related organisms broadly characterized by a single posterior flagellum—all phyla except for the chytrids have lost their posterior flagella. Fungi are unusual among the eukaryotes in having a cell wall that, in addition to glucans (e.g., β-1,3-glucan) and other typical components, also contains the biopolymer chitin.

 

Macroscopic structures

Fungal mycelia can become visible to the naked eye, for example, on various surfaces and substrates, such as damp walls and spoiled food, where they are commonly called molds. Mycelia grown on solid agar media in laboratory petri dishes are usually referred to as colonies. These colonies can exhibit growth shapes and colors (due to spores or pigmentation) that can be used as diagnostic features in the identification of species or groups. Some individual fungal colonies can reach extraordinary dimensions and ages as in the case of a clonal colony of Armillaria solidipes, which extends over an area of more than 900 ha (3.5 square miles), with an estimated age of nearly 9,000 years.

 

The apothecium—a specialized structure important in sexual reproduction in the ascomycetes—is a cup-shaped fruit body that is often macroscopic and holds the hymenium, a layer of tissue containing the spore-bearing cells. The fruit bodies of the basidiomycetes (basidiocarps) and some ascomycetes can sometimes grow very large, and many are well known as mushrooms.

 

Growth and physiology

Time-lapse photography sequence of a peach becoming progressively discolored and disfigured

Mold growth covering a decaying peach. The frames were taken approximately 12 hours apart over a period of six days.

The growth of fungi as hyphae on or in solid substrates or as single cells in aquatic environments is adapted for the efficient extraction of nutrients, because these growth forms have high surface area to volume ratios. Hyphae are specifically adapted for growth on solid surfaces, and to invade substrates and tissues. They can exert large penetrative mechanical forces; for example, many plant pathogens, including Magnaporthe grisea, form a structure called an appressorium that evolved to puncture plant tissues.[71] The pressure generated by the appressorium, directed against the plant epidermis, can exceed 8 megapascals (1,200 psi).[71] The filamentous fungus Paecilomyces lilacinus uses a similar structure to penetrate the eggs of nematodes.

 

The mechanical pressure exerted by the appressorium is generated from physiological processes that increase intracellular turgor by producing osmolytes such as glycerol. Adaptations such as these are complemented by hydrolytic enzymes secreted into the environment to digest large organic molecules—such as polysaccharides, proteins, and lipids—into smaller molecules that may then be absorbed as nutrients. The vast majority of filamentous fungi grow in a polar fashion (extending in one direction) by elongation at the tip (apex) of the hypha. Other forms of fungal growth include intercalary extension (longitudinal expansion of hyphal compartments that are below the apex) as in the case of some endophytic fungi, or growth by volume expansion during the development of mushroom stipes and other large organs. Growth of fungi as multicellular structures consisting of somatic and reproductive cells—a feature independently evolved in animals and plants—has several functions, including the development of fruit bodies for dissemination of sexual spores (see above) and biofilms for substrate colonization and intercellular communication.

 

Fungi are traditionally considered heterotrophs, organisms that rely solely on carbon fixed by other organisms for metabolism. Fungi have evolved a high degree of metabolic versatility that allows them to use a diverse range of organic substrates for growth, including simple compounds such as nitrate, ammonia, acetate, or ethanol. In some species the pigment melanin may play a role in extracting energy from ionizing radiation, such as gamma radiation. This form of "radiotrophic" growth has been described for only a few species, the effects on growth rates are small, and the underlying biophysical and biochemical processes are not well known. This process might bear similarity to CO2 fixation via visible light, but instead uses ionizing radiation as a source of energy.

 

Reproduction

Two thickly stemmed brownish mushrooms with scales on the upper surface, growing out of a tree trunk

Polyporus squamosus

Fungal reproduction is complex, reflecting the differences in lifestyles and genetic makeup within this diverse kingdom of organisms. It is estimated that a third of all fungi reproduce using more than one method of propagation; for example, reproduction may occur in two well-differentiated stages within the life cycle of a species, the teleomorph (sexual reproduction) and the anamorph (asexual reproduction). Environmental conditions trigger genetically determined developmental states that lead to the creation of specialized structures for sexual or asexual reproduction. These structures aid reproduction by efficiently dispersing spores or spore-containing propagules.

 

Asexual reproduction

Asexual reproduction occurs via vegetative spores (conidia) or through mycelial fragmentation. Mycelial fragmentation occurs when a fungal mycelium separates into pieces, and each component grows into a separate mycelium. Mycelial fragmentation and vegetative spores maintain clonal populations adapted to a specific niche, and allow more rapid dispersal than sexual reproduction. The "Fungi imperfecti" (fungi lacking the perfect or sexual stage) or Deuteromycota comprise all the species that lack an observable sexual cycle. Deuteromycota (alternatively known as Deuteromycetes, conidial fungi, or mitosporic fungi) is not an accepted taxonomic clade and is now taken to mean simply fungi that lack a known sexual stage.

 

Sexual reproduction

See also: Mating in fungi and Sexual selection in fungi

Sexual reproduction with meiosis has been directly observed in all fungal phyla except Glomeromycota (genetic analysis suggests meiosis in Glomeromycota as well). It differs in many aspects from sexual reproduction in animals or plants. Differences also exist between fungal groups and can be used to discriminate species by morphological differences in sexual structures and reproductive strategies. Mating experiments between fungal isolates may identify species on the basis of biological species concepts. The major fungal groupings have initially been delineated based on the morphology of their sexual structures and spores; for example, the spore-containing structures, asci and basidia, can be used in the identification of ascomycetes and basidiomycetes, respectively. Fungi employ two mating systems: heterothallic species allow mating only between individuals of the opposite mating type, whereas homothallic species can mate, and sexually reproduce, with any other individual or itself.

 

Most fungi have both a haploid and a diploid stage in their life cycles. In sexually reproducing fungi, compatible individuals may combine by fusing their hyphae together into an interconnected network; this process, anastomosis, is required for the initiation of the sexual cycle. Many ascomycetes and basidiomycetes go through a dikaryotic stage, in which the nuclei inherited from the two parents do not combine immediately after cell fusion, but remain separate in the hyphal cells (see heterokaryosis).

 

In ascomycetes, dikaryotic hyphae of the hymenium (the spore-bearing tissue layer) form a characteristic hook (crozier) at the hyphal septum. During cell division, the formation of the hook ensures proper distribution of the newly divided nuclei into the apical and basal hyphal compartments. An ascus (plural asci) is then formed, in which karyogamy (nuclear fusion) occurs. Asci are embedded in an ascocarp, or fruiting body. Karyogamy in the asci is followed immediately by meiosis and the production of ascospores. After dispersal, the ascospores may germinate and form a new haploid mycelium.

 

Sexual reproduction in basidiomycetes is similar to that of the ascomycetes. Compatible haploid hyphae fuse to produce a dikaryotic mycelium. However, the dikaryotic phase is more extensive in the basidiomycetes, often also present in the vegetatively growing mycelium. A specialized anatomical structure, called a clamp connection, is formed at each hyphal septum. As with the structurally similar hook in the ascomycetes, the clamp connection in the basidiomycetes is required for controlled transfer of nuclei during cell division, to maintain the dikaryotic stage with two genetically different nuclei in each hyphal compartment. A basidiocarp is formed in which club-like structures known as basidia generate haploid basidiospores after karyogamy and meiosis. The most commonly known basidiocarps are mushrooms, but they may also take other forms (see Morphology section).

 

In fungi formerly classified as Zygomycota, haploid hyphae of two individuals fuse, forming a gametangium, a specialized cell structure that becomes a fertile gamete-producing cell. The gametangium develops into a zygospore, a thick-walled spore formed by the union of gametes. When the zygospore germinates, it undergoes meiosis, generating new haploid hyphae, which may then form asexual sporangiospores. These sporangiospores allow the fungus to rapidly disperse and germinate into new genetically identical haploid fungal mycelia.

 

Spore dispersal

The spores of most of the researched species of fungi are transported by wind. Such species often produce dry or hydrophobic spores that do not absorb water and are readily scattered by raindrops, for example. In other species, both asexual and sexual spores or sporangiospores are often actively dispersed by forcible ejection from their reproductive structures. This ejection ensures exit of the spores from the reproductive structures as well as traveling through the air over long distances.

 

Specialized mechanical and physiological mechanisms, as well as spore surface structures (such as hydrophobins), enable efficient spore ejection. For example, the structure of the spore-bearing cells in some ascomycete species is such that the buildup of substances affecting cell volume and fluid balance enables the explosive discharge of spores into the air. The forcible discharge of single spores termed ballistospores involves formation of a small drop of water (Buller's drop), which upon contact with the spore leads to its projectile release with an initial acceleration of more than 10,000 g; the net result is that the spore is ejected 0.01–0.02 cm, sufficient distance for it to fall through the gills or pores into the air below. Other fungi, like the puffballs, rely on alternative mechanisms for spore release, such as external mechanical forces. The hydnoid fungi (tooth fungi) produce spores on pendant, tooth-like or spine-like projections. The bird's nest fungi use the force of falling water drops to liberate the spores from cup-shaped fruiting bodies. Another strategy is seen in the stinkhorns, a group of fungi with lively colors and putrid odor that attract insects to disperse their spores.

 

Homothallism

In homothallic sexual reproduction, two haploid nuclei derived from the same individual fuse to form a zygote that can then undergo meiosis. Homothallic fungi include species with an Aspergillus-like asexual stage (anamorphs) occurring in numerous different genera, several species of the ascomycete genus Cochliobolus, and the ascomycete Pneumocystis jirovecii. The earliest mode of sexual reproduction among eukaryotes was likely homothallism, that is, self-fertile unisexual reproduction.

 

Other sexual processes

Besides regular sexual reproduction with meiosis, certain fungi, such as those in the genera Penicillium and Aspergillus, may exchange genetic material via parasexual processes, initiated by anastomosis between hyphae and plasmogamy of fungal cells. The frequency and relative importance of parasexual events is unclear and may be lower than other sexual processes. It is known to play a role in intraspecific hybridization and is likely required for hybridization between species, which has been associated with major events in fungal evolution.

 

Evolution

In contrast to plants and animals, the early fossil record of the fungi is meager. Factors that likely contribute to the under-representation of fungal species among fossils include the nature of fungal fruiting bodies, which are soft, fleshy, and easily degradable tissues and the microscopic dimensions of most fungal structures, which therefore are not readily evident. Fungal fossils are difficult to distinguish from those of other microbes, and are most easily identified when they resemble extant fungi. Often recovered from a permineralized plant or animal host, these samples are typically studied by making thin-section preparations that can be examined with light microscopy or transmission electron microscopy. Researchers study compression fossils by dissolving the surrounding matrix with acid and then using light or scanning electron microscopy to examine surface details.

 

The earliest fossils possessing features typical of fungi date to the Paleoproterozoic era, some 2,400 million years ago (Ma); these multicellular benthic organisms had filamentous structures capable of anastomosis. Other studies (2009) estimate the arrival of fungal organisms at about 760–1060 Ma on the basis of comparisons of the rate of evolution in closely related groups. The oldest fossilizied mycelium to be identified from its molecular composition is between 715 and 810 million years old. For much of the Paleozoic Era (542–251 Ma), the fungi appear to have been aquatic and consisted of organisms similar to the extant chytrids in having flagellum-bearing spores. The evolutionary adaptation from an aquatic to a terrestrial lifestyle necessitated a diversification of ecological strategies for obtaining nutrients, including parasitism, saprobism, and the development of mutualistic relationships such as mycorrhiza and lichenization. Studies suggest that the ancestral ecological state of the Ascomycota was saprobism, and that independent lichenization events have occurred multiple times.

 

In May 2019, scientists reported the discovery of a fossilized fungus, named Ourasphaira giraldae, in the Canadian Arctic, that may have grown on land a billion years ago, well before plants were living on land. Pyritized fungus-like microfossils preserved in the basal Ediacaran Doushantuo Formation (~635 Ma) have been reported in South China. Earlier, it had been presumed that the fungi colonized the land during the Cambrian (542–488.3 Ma), also long before land plants. Fossilized hyphae and spores recovered from the Ordovician of Wisconsin (460 Ma) resemble modern-day Glomerales, and existed at a time when the land flora likely consisted of only non-vascular bryophyte-like plants. Prototaxites, which was probably a fungus or lichen, would have been the tallest organism of the late Silurian and early Devonian. Fungal fossils do not become common and uncontroversial until the early Devonian (416–359.2 Ma), when they occur abundantly in the Rhynie chert, mostly as Zygomycota and Chytridiomycota. At about this same time, approximately 400 Ma, the Ascomycota and Basidiomycota diverged, and all modern classes of fungi were present by the Late Carboniferous (Pennsylvanian, 318.1–299 Ma).

 

Lichens formed a component of the early terrestrial ecosystems, and the estimated age of the oldest terrestrial lichen fossil is 415 Ma; this date roughly corresponds to the age of the oldest known sporocarp fossil, a Paleopyrenomycites species found in the Rhynie Chert. The oldest fossil with microscopic features resembling modern-day basidiomycetes is Palaeoancistrus, found permineralized with a fern from the Pennsylvanian. Rare in the fossil record are the Homobasidiomycetes (a taxon roughly equivalent to the mushroom-producing species of the Agaricomycetes). Two amber-preserved specimens provide evidence that the earliest known mushroom-forming fungi (the extinct species Archaeomarasmius leggetti) appeared during the late Cretaceous, 90 Ma.

 

Some time after the Permian–Triassic extinction event (251.4 Ma), a fungal spike (originally thought to be an extraordinary abundance of fungal spores in sediments) formed, suggesting that fungi were the dominant life form at this time, representing nearly 100% of the available fossil record for this period. However, the relative proportion of fungal spores relative to spores formed by algal species is difficult to assess, the spike did not appear worldwide, and in many places it did not fall on the Permian–Triassic boundary.

 

Sixty-five million years ago, immediately after the Cretaceous–Paleogene extinction event that famously killed off most dinosaurs, there was a dramatic increase in evidence of fungi; apparently the death of most plant and animal species led to a huge fungal bloom like "a massive compost heap".

 

Taxonomy

Although commonly included in botany curricula and textbooks, fungi are more closely related to animals than to plants and are placed with the animals in the monophyletic group of opisthokonts. Analyses using molecular phylogenetics support a monophyletic origin of fungi. The taxonomy of fungi is in a state of constant flux, especially due to research based on DNA comparisons. These current phylogenetic analyses often overturn classifications based on older and sometimes less discriminative methods based on morphological features and biological species concepts obtained from experimental matings.

 

There is no unique generally accepted system at the higher taxonomic levels and there are frequent name changes at every level, from species upwards. Efforts among researchers are now underway to establish and encourage usage of a unified and more consistent nomenclature. Until relatively recent (2012) changes to the International Code of Nomenclature for algae, fungi and plants, fungal species could also have multiple scientific names depending on their life cycle and mode (sexual or asexual) of reproduction. Web sites such as Index Fungorum and MycoBank are officially recognized nomenclatural repositories and list current names of fungal species (with cross-references to older synonyms).

 

The 2007 classification of Kingdom Fungi is the result of a large-scale collaborative research effort involving dozens of mycologists and other scientists working on fungal taxonomy. It recognizes seven phyla, two of which—the Ascomycota and the Basidiomycota—are contained within a branch representing subkingdom Dikarya, the most species rich and familiar group, including all the mushrooms, most food-spoilage molds, most plant pathogenic fungi, and the beer, wine, and bread yeasts. The accompanying cladogram depicts the major fungal taxa and their relationship to opisthokont and unikont organisms, based on the work of Philippe Silar, "The Mycota: A Comprehensive Treatise on Fungi as Experimental Systems for Basic and Applied Research" and Tedersoo et al. 2018. The lengths of the branches are not proportional to evolutionary distances.

 

The major phyla (sometimes called divisions) of fungi have been classified mainly on the basis of characteristics of their sexual reproductive structures. As of 2019, nine major lineages have been identified: Opisthosporidia, Chytridiomycota, Neocallimastigomycota, Blastocladiomycota, Zoopagomycotina, Mucoromycota, Glomeromycota, Ascomycota and Basidiomycota.

 

Phylogenetic analysis has demonstrated that the Microsporidia, unicellular parasites of animals and protists, are fairly recent and highly derived endobiotic fungi (living within the tissue of another species). Previously considered to be "primitive" protozoa, they are now thought to be either a basal branch of the Fungi, or a sister group–each other's closest evolutionary relative.

 

The Chytridiomycota are commonly known as chytrids. These fungi are distributed worldwide. Chytrids and their close relatives Neocallimastigomycota and Blastocladiomycota (below) are the only fungi with active motility, producing zoospores that are capable of active movement through aqueous phases with a single flagellum, leading early taxonomists to classify them as protists. Molecular phylogenies, inferred from rRNA sequences in ribosomes, suggest that the Chytrids are a basal group divergent from the other fungal phyla, consisting of four major clades with suggestive evidence for paraphyly or possibly polyphyly.

 

The Blastocladiomycota were previously considered a taxonomic clade within the Chytridiomycota. Molecular data and ultrastructural characteristics, however, place the Blastocladiomycota as a sister clade to the Zygomycota, Glomeromycota, and Dikarya (Ascomycota and Basidiomycota). The blastocladiomycetes are saprotrophs, feeding on decomposing organic matter, and they are parasites of all eukaryotic groups. Unlike their close relatives, the chytrids, most of which exhibit zygotic meiosis, the blastocladiomycetes undergo sporic meiosis.

 

The Neocallimastigomycota were earlier placed in the phylum Chytridiomycota. Members of this small phylum are anaerobic organisms, living in the digestive system of larger herbivorous mammals and in other terrestrial and aquatic environments enriched in cellulose (e.g., domestic waste landfill sites). They lack mitochondria but contain hydrogenosomes of mitochondrial origin. As in the related chrytrids, neocallimastigomycetes form zoospores that are posteriorly uniflagellate or polyflagellate.

 

Microscopic view of a layer of translucent grayish cells, some containing small dark-color spheres

Arbuscular mycorrhiza seen under microscope. Flax root cortical cells containing paired arbuscules.

Cross-section of a cup-shaped structure showing locations of developing meiotic asci (upper edge of cup, left side, arrows pointing to two gray cells containing four and two small circles), sterile hyphae (upper edge of cup, right side, arrows pointing to white cells with a single small circle in them), and mature asci (upper edge of cup, pointing to two gray cells with eight small circles in them)

Diagram of an apothecium (the typical cup-like reproductive structure of Ascomycetes) showing sterile tissues as well as developing and mature asci.

Members of the Glomeromycota form arbuscular mycorrhizae, a form of mutualist symbiosis wherein fungal hyphae invade plant root cells and both species benefit from the resulting increased supply of nutrients. All known Glomeromycota species reproduce asexually. The symbiotic association between the Glomeromycota and plants is ancient, with evidence dating to 400 million years ago. Formerly part of the Zygomycota (commonly known as 'sugar' and 'pin' molds), the Glomeromycota were elevated to phylum status in 2001 and now replace the older phylum Zygomycota. Fungi that were placed in the Zygomycota are now being reassigned to the Glomeromycota, or the subphyla incertae sedis Mucoromycotina, Kickxellomycotina, the Zoopagomycotina and the Entomophthoromycotina. Some well-known examples of fungi formerly in the Zygomycota include black bread mold (Rhizopus stolonifer), and Pilobolus species, capable of ejecting spores several meters through the air. Medically relevant genera include Mucor, Rhizomucor, and Rhizopus.

 

The Ascomycota, commonly known as sac fungi or ascomycetes, constitute the largest taxonomic group within the Eumycota. These fungi form meiotic spores called ascospores, which are enclosed in a special sac-like structure called an ascus. This phylum includes morels, a few mushrooms and truffles, unicellular yeasts (e.g., of the genera Saccharomyces, Kluyveromyces, Pichia, and Candida), and many filamentous fungi living as saprotrophs, parasites, and mutualistic symbionts (e.g. lichens). Prominent and important genera of filamentous ascomycetes include Aspergillus, Penicillium, Fusarium, and Claviceps. Many ascomycete species have only been observed undergoing asexual reproduction (called anamorphic species), but analysis of molecular data has often been able to identify their closest teleomorphs in the Ascomycota. Because the products of meiosis are retained within the sac-like ascus, ascomycetes have been used for elucidating principles of genetics and heredity (e.g., Neurospora crassa).

 

Members of the Basidiomycota, commonly known as the club fungi or basidiomycetes, produce meiospores called basidiospores on club-like stalks called basidia. Most common mushrooms belong to this group, as well as rust and smut fungi, which are major pathogens of grains. Other important basidiomycetes include the maize pathogen Ustilago maydis, human commensal species of the genus Malassezia, and the opportunistic human pathogen, Cryptococcus neoformans.

 

Fungus-like organisms

Because of similarities in morphology and lifestyle, the slime molds (mycetozoans, plasmodiophorids, acrasids, Fonticula and labyrinthulids, now in Amoebozoa, Rhizaria, Excavata, Opisthokonta and Stramenopiles, respectively), water molds (oomycetes) and hyphochytrids (both Stramenopiles) were formerly classified in the kingdom Fungi, in groups like Mastigomycotina, Gymnomycota and Phycomycetes. The slime molds were studied also as protozoans, leading to an ambiregnal, duplicated taxonomy.

 

Unlike true fungi, the cell walls of oomycetes contain cellulose and lack chitin. Hyphochytrids have both chitin and cellulose. Slime molds lack a cell wall during the assimilative phase (except labyrinthulids, which have a wall of scales), and take in nutrients by ingestion (phagocytosis, except labyrinthulids) rather than absorption (osmotrophy, as fungi, labyrinthulids, oomycetes and hyphochytrids). Neither water molds nor slime molds are closely related to the true fungi, and, therefore, taxonomists no longer group them in the kingdom Fungi. Nonetheless, studies of the oomycetes and myxomycetes are still often included in mycology textbooks and primary research literature.

 

The Eccrinales and Amoebidiales are opisthokont protists, previously thought to be zygomycete fungi. Other groups now in Opisthokonta (e.g., Corallochytrium, Ichthyosporea) were also at given time classified as fungi. The genus Blastocystis, now in Stramenopiles, was originally classified as a yeast. Ellobiopsis, now in Alveolata, was considered a chytrid. The bacteria were also included in fungi in some classifications, as the group Schizomycetes.

 

The Rozellida clade, including the "ex-chytrid" Rozella, is a genetically disparate group known mostly from environmental DNA sequences that is a sister group to fungi. Members of the group that have been isolated lack the chitinous cell wall that is characteristic of fungi. Alternatively, Rozella can be classified as a basal fungal group.

 

The nucleariids may be the next sister group to the eumycete clade, and as such could be included in an expanded fungal kingdom. Many Actinomycetales (Actinomycetota), a group with many filamentous bacteria, were also long believed to be fungi.

 

Ecology

Although often inconspicuous, fungi occur in every environment on Earth and play very important roles in most ecosystems. Along with bacteria, fungi are the major decomposers in most terrestrial (and some aquatic) ecosystems, and therefore play a critical role in biogeochemical cycles and in many food webs. As decomposers, they play an essential role in nutrient cycling, especially as saprotrophs and symbionts, degrading organic matter to inorganic molecules, which can then re-enter anabolic metabolic pathways in plants or other organisms.

 

Symbiosis

Many fungi have important symbiotic relationships with organisms from most if not all kingdoms. These interactions can be mutualistic or antagonistic in nature, or in the case of commensal fungi are of no apparent benefit or detriment to the host.

 

With plants

Mycorrhizal symbiosis between plants and fungi is one of the most well-known plant–fungus associations and is of significant importance for plant growth and persistence in many ecosystems; over 90% of all plant species engage in mycorrhizal relationships with fungi and are dependent upon this relationship for survival.

 

A microscopic view of blue-stained cells, some with dark wavy lines in them

The dark filaments are hyphae of the endophytic fungus Epichloë coenophiala in the intercellular spaces of tall fescue leaf sheath tissue

The mycorrhizal symbiosis is ancient, dating back to at least 400 million years. It often increases the plant's uptake of inorganic compounds, such as nitrate and phosphate from soils having low concentrations of these key plant nutrients. The fungal partners may also mediate plant-to-plant transfer of carbohydrates and other nutrients. Such mycorrhizal communities are called "common mycorrhizal networks". A special case of mycorrhiza is myco-heterotrophy, whereby the plant parasitizes the fungus, obtaining all of its nutrients from its fungal symbiont. Some fungal species inhabit the tissues inside roots, stems, and leaves, in which case they are called endophytes. Similar to mycorrhiza, endophytic colonization by fungi may benefit both symbionts; for example, endophytes of grasses impart to their host increased resistance to herbivores and other environmental stresses and receive food and shelter from the plant in return.

 

With algae and cyanobacteria

A green, leaf-like structure attached to a tree, with a pattern of ridges and depression on the bottom surface

The lichen Lobaria pulmonaria, a symbiosis of fungal, algal, and cyanobacterial species

Lichens are a symbiotic relationship between fungi and photosynthetic algae or cyanobacteria. The photosynthetic partner in the relationship is referred to in lichen terminology as a "photobiont". The fungal part of the relationship is composed mostly of various species of ascomycetes and a few basidiomycetes. Lichens occur in every ecosystem on all continents, play a key role in soil formation and the initiation of biological succession, and are prominent in some extreme environments, including polar, alpine, and semiarid desert regions. They are able to grow on inhospitable surfaces, including bare soil, rocks, tree bark, wood, shells, barnacles and leaves. As in mycorrhizas, the photobiont provides sugars and other carbohydrates via photosynthesis to the fungus, while the fungus provides minerals and water to the photobiont. The functions of both symbiotic organisms are so closely intertwined that they function almost as a single organism; in most cases the resulting organism differs greatly from the individual components. Lichenization is a common mode of nutrition for fungi; around 27% of known fungi—more than 19,400 species—are lichenized. Characteristics common to most lichens include obtaining organic carbon by photosynthesis, slow growth, small size, long life, long-lasting (seasonal) vegetative reproductive structures, mineral nutrition obtained largely from airborne sources, and greater tolerance of desiccation than most other photosynthetic organisms in the same habitat.

 

With insects

Many insects also engage in mutualistic relationships with fungi. Several groups of ants cultivate fungi in the order Chaetothyriales for several purposes: as a food source, as a structural component of their nests, and as a part of an ant/plant symbiosis in the domatia (tiny chambers in plants that house arthropods). Ambrosia beetles cultivate various species of fungi in the bark of trees that they infest. Likewise, females of several wood wasp species (genus Sirex) inject their eggs together with spores of the wood-rotting fungus Amylostereum areolatum into the sapwood of pine trees; the growth of the fungus provides ideal nutritional conditions for the development of the wasp larvae. At least one species of stingless bee has a relationship with a fungus in the genus Monascus, where the larvae consume and depend on fungus transferred from old to new nests. Termites on the African savannah are also known to cultivate fungi, and yeasts of the genera Candida and Lachancea inhabit the gut of a wide range of insects, including neuropterans, beetles, and cockroaches; it is not known whether these fungi benefit their hosts. Fungi growing in dead wood are essential for xylophagous insects (e.g. woodboring beetles). They deliver nutrients needed by xylophages to nutritionally scarce dead wood. Thanks to this nutritional enrichment the larvae of the woodboring insect is able to grow and develop to adulthood. The larvae of many families of fungicolous flies, particularly those within the superfamily Sciaroidea such as the Mycetophilidae and some Keroplatidae feed on fungal fruiting bodies and sterile mycorrhizae.

 

A thin brown stick positioned horizontally with roughly two dozen clustered orange-red leaves originating from a single point in the middle of the stick. These orange leaves are three to four times larger than the few other green leaves growing out of the stick, and are covered on the lower leaf surface with hundreds of tiny bumps. The background shows the green leaves and branches of neighboring shrubs.

The plant pathogen Puccinia magellanicum (calafate rust) causes the defect known as witch's broom, seen here on a barberry shrub in Chile.

 

Gram stain of Candida albicans from a vaginal swab from a woman with candidiasis, showing hyphae, and chlamydospores, which are 2–4 µm in diameter.

Many fungi are parasites on plants, animals (including humans), and other fungi. Serious pathogens of many cultivated plants causing extensive damage and losses to agriculture and forestry include the rice blast fungus Magnaporthe oryzae, tree pathogens such as Ophiostoma ulmi and Ophiostoma novo-ulmi causing Dutch elm disease, Cryphonectria parasitica responsible for chestnut blight, and Phymatotrichopsis omnivora causing Texas Root Rot, and plant pathogens in the genera Fusarium, Ustilago, Alternaria, and Cochliobolus. Some carnivorous fungi, like Paecilomyces lilacinus, are predators of nematodes, which they capture using an array of specialized structures such as constricting rings or adhesive nets. Many fungi that are plant pathogens, such as Magnaporthe oryzae, can switch from being biotrophic (parasitic on living plants) to being necrotrophic (feeding on the dead tissues of plants they have killed). This same principle is applied to fungi-feeding parasites, including Asterotremella albida, which feeds on the fruit bodies of other fungi both while they are living and after they are dead.

 

Some fungi can cause serious diseases in humans, several of which may be fatal if untreated. These include aspergillosis, candidiasis, coccidioidomycosis, cryptococcosis, histoplasmosis, mycetomas, and paracoccidioidomycosis. Furthermore, persons with immuno-deficiencies are particularly susceptible to disease by genera such as Aspergillus, Candida, Cryptoccocus, Histoplasma, and Pneumocystis. Other fungi can attack eyes, nails, hair, and especially skin, the so-called dermatophytic and keratinophilic fungi, and cause local infections such as ringworm and athlete's foot. Fungal spores are also a cause of allergies, and fungi from different taxonomic groups can evoke allergic reactions.

 

As targets of mycoparasites

Organisms that parasitize fungi are known as mycoparasitic organisms. About 300 species of fungi and fungus-like organisms, belonging to 13 classes and 113 genera, are used as biocontrol agents against plant fungal diseases. Fungi can also act as mycoparasites or antagonists of other fungi, such as Hypomyces chrysospermus, which grows on bolete mushrooms. Fungi can also become the target of infection by mycoviruses.

 

Communication

Main article: Mycorrhizal networks

There appears to be electrical communication between fungi in word-like components according to spiking characteristics.

 

Possible impact on climate

According to a study published in the academic journal Current Biology, fungi can soak from the atmosphere around 36% of global fossil fuel greenhouse gas emissions.

 

Mycotoxins

(6aR,9R)-N-((2R,5S,10aS,10bS)-5-benzyl-10b-hydroxy-2-methyl-3,6-dioxooctahydro-2H-oxazolo[3,2-a] pyrrolo[2,1-c]pyrazin-2-yl)-7-methyl-4,6,6a,7,8,9-hexahydroindolo[4,3-fg] quinoline-9-carboxamide

Ergotamine, a major mycotoxin produced by Claviceps species, which if ingested can cause gangrene, convulsions, and hallucinations

Many fungi produce biologically active compounds, several of which are toxic to animals or plants and are therefore called mycotoxins. Of particular relevance to humans are mycotoxins produced by molds causing food spoilage, and poisonous mushrooms (see above). Particularly infamous are the lethal amatoxins in some Amanita mushrooms, and ergot alkaloids, which have a long history of causing serious epidemics of ergotism (St Anthony's Fire) in people consuming rye or related cereals contaminated with sclerotia of the ergot fungus, Claviceps purpurea. Other notable mycotoxins include the aflatoxins, which are insidious liver toxins and highly carcinogenic metabolites produced by certain Aspergillus species often growing in or on grains and nuts consumed by humans, ochratoxins, patulin, and trichothecenes (e.g., T-2 mycotoxin) and fumonisins, which have significant impact on human food supplies or animal livestock.

 

Mycotoxins are secondary metabolites (or natural products), and research has established the existence of biochemical pathways solely for the purpose of producing mycotoxins and other natural products in fungi. Mycotoxins may provide fitness benefits in terms of physiological adaptation, competition with other microbes and fungi, and protection from consumption (fungivory). Many fungal secondary metabolites (or derivatives) are used medically, as described under Human use below.

 

Pathogenic mechanisms

Ustilago maydis is a pathogenic plant fungus that causes smut disease in maize and teosinte. Plants have evolved efficient defense systems against pathogenic microbes such as U. maydis. A rapid defense reaction after pathogen attack is the oxidative burst where the plant produces reactive oxygen species at the site of the attempted invasion. U. maydis can respond to the oxidative burst with an oxidative stress response, regulated by the gene YAP1. The response protects U. maydis from the host defense, and is necessary for the pathogen's virulence. Furthermore, U. maydis has a well-established recombinational DNA repair system which acts during mitosis and meiosis. The system may assist the pathogen in surviving DNA damage arising from the host plant's oxidative defensive response to infection.

 

Cryptococcus neoformans is an encapsulated yeast that can live in both plants and animals. C. neoformans usually infects the lungs, where it is phagocytosed by alveolar macrophages. Some C. neoformans can survive inside macrophages, which appears to be the basis for latency, disseminated disease, and resistance to antifungal agents. One mechanism by which C. neoformans survives the hostile macrophage environment is by up-regulating the expression of genes involved in the oxidative stress response. Another mechanism involves meiosis. The majority of C. neoformans are mating "type a". Filaments of mating "type a" ordinarily have haploid nuclei, but they can become diploid (perhaps by endoduplication or by stimulated nuclear fusion) to form blastospores. The diploid nuclei of blastospores can undergo meiosis, including recombination, to form haploid basidiospores that can be dispersed. This process is referred to as monokaryotic fruiting. This process requires a gene called DMC1, which is a conserved homologue of genes recA in bacteria and RAD51 in eukaryotes, that mediates homologous chromosome pairing during meiosis and repair of DNA double-strand breaks. Thus, C. neoformans can undergo a meiosis, monokaryotic fruiting, that promotes recombinational repair in the oxidative, DNA damaging environment of the host macrophage, and the repair capability may contribute to its virulence.

 

Human use

See also: Human interactions with fungi

Microscopic view of five spherical structures; one of the spheres is considerably smaller than the rest and attached to one of the larger spheres

Saccharomyces cerevisiae cells shown with DIC microscopy

The human use of fungi for food preparation or preservation and other purposes is extensive and has a long history. Mushroom farming and mushroom gathering are large industries in many countries. The study of the historical uses and sociological impact of fungi is known as ethnomycology. Because of the capacity of this group to produce an enormous range of natural products with antimicrobial or other biological activities, many species have long been used or are being developed for industrial production of antibiotics, vitamins, and anti-cancer and cholesterol-lowering drugs. Methods have been developed for genetic engineering of fungi, enabling metabolic engineering of fungal species. For example, genetic modification of yeast species—which are easy to grow at fast rates in large fermentation vessels—has opened up ways of pharmaceutical production that are potentially more efficient than production by the original source organisms. Fungi-based industries are sometimes considered to be a major part of a growing bioeconomy, with applications under research and development including use for textiles, meat substitution and general fungal biotechnology.

 

Therapeutic uses

Modern chemotherapeutics

Many species produce metabolites that are major sources of pharmacologically active drugs.

 

Antibiotics

Particularly important are the antibiotics, including the penicillins, a structurally related group of β-lactam antibiotics that are synthesized from small peptides. Although naturally occurring penicillins such as penicillin G (produced by Penicillium chrysogenum) have a relatively narrow spectrum of biological activity, a wide range of other penicillins can be produced by chemical modification of the natural penicillins. Modern penicillins are semisynthetic compounds, obtained initially from fermentation cultures, but then structurally altered for specific desirable properties. Other antibiotics produced by fungi include: ciclosporin, commonly used as an immunosuppressant during transplant surgery; and fusidic acid, used to help control infection from methicillin-resistant Staphylococcus aureus bacteria. Widespread use of antibiotics for the treatment of bacterial diseases, such as tuberculosis, syphilis, leprosy, and others began in the early 20th century and continues to date. In nature, antibiotics of fungal or bacterial origin appear to play a dual role: at high concentrations they act as chemical defense against competition with other microorganisms in species-rich environments, such as the rhizosphere, and at low concentrations as quorum-sensing molecules for intra- or interspecies signaling.

 

Other

Other drugs produced by fungi include griseofulvin isolated from Penicillium griseofulvum, used to treat fungal infections, and statins (HMG-CoA reductase inhibitors), used to inhibit cholesterol synthesis. Examples of statins found in fungi include mevastatin from Penicillium citrinum and lovastatin from Aspergillus terreus and the oyster mushroom. Psilocybin from fungi is investigated for therapeutic use and appears to cause global increases in brain network integration. Fungi produce compounds that inhibit viruses and cancer cells. Specific metabolites, such as polysaccharide-K, ergotamine, and β-lactam antibiotics, are routinely used in clinical medicine. The shiitake mushroom is a source of lentinan, a clinical drug approved for use in cancer treatments in several countries, including Japan. In Europe and Japan, polysaccharide-K (brand name Krestin), a chemical derived from Trametes versicolor, is an approved adjuvant for cancer therapy.

 

Traditional medicine

Upper surface view of a kidney-shaped fungus, brownish-red with a lighter yellow-brown margin, and a somewhat varnished or shiny appearance

Two dried yellow-orange caterpillars, one with a curly grayish fungus growing out of one of its ends. The grayish fungus is roughly equal to or slightly greater in length than the caterpillar, and tapers in thickness to a narrow end.

The fungi Ganoderma lucidum (left) and Ophiocordyceps sinensis (right) are used in traditional medicine practices

Certain mushrooms are used as supposed therapeutics in folk medicine practices, such as traditional Chinese medicine. Mushrooms with a history of such use include Agaricus subrufescens, Ganoderma lucidum, and Ophiocordyceps sinensis.

 

Cultured foods

Baker's yeast or Saccharomyces cerevisiae, a unicellular fungus, is used to make bread and other wheat-based products, such as pizza dough and dumplings. Yeast species of the genus Saccharomyces are also used to produce alcoholic beverages through fermentation. Shoyu koji mold (Aspergillus oryzae) is an essential ingredient in brewing Shoyu (soy sauce) and sake, and the preparation of miso while Rhizopus species are used for making tempeh. Several of these fungi are domesticated species that were bred or selected according to their capacity to ferment food without producing harmful mycotoxins (see below), which are produced by very closely related Aspergilli. Quorn, a meat substitute, is made from Fusarium venenatum.

Stone & porcini mushroom = Noun

(Stein & Pilz = Steinpilz )

  

Mushrooms (fungi) are eukaryotic organisms whose cells contain mitochondria and cytoskeleton. In biological classification, besides animals and plants, they form an independent kingdom, which includes both single-celled organisms such as yeast and multicellular organisms such as molds and mushrooms or toadstools.

 

Fungi multiply and spread sexually and asexually through spores and vegetative propagation through (possibly with fragmentation) of their sometimes very long-lived mycelia, or mycorrhiza.

The science of the mushrooms is the mycology.

 

- - - - - - - - - -

 

Pilze (Fungi) sind eukaryotische Lebewesen, deren Zellen Mitochondrien und ein Zellskelett enthalten. In der biologischen Klassifikation bilden sie neben Tieren und Pflanzen ein eigenständiges Reich, zu dem sowohl Einzeller wie die Backhefe als auch Vielzeller wie die Schimmelpilze und die Ständerpilze gehören.

 

Pilze vermehren und verbreiten sich geschlechtlich und ungeschlechtlich durch Sporen und vegetativ durch Ausbreitung (eventuell mit Fragmentierung) ihrer manchmal sehr langlebigen Myzelien oder Mykorrhizen.

Die Wissenschaft von den Pilzen ist die Mykologie.

- wikipedia -

     

violation of copyright will be

prosecuted

 

illegales downloaden meiner Bilder wird

automatisch strafrechtlich verfolgt

   

© 06-2013 by

Richard von Lenzano

Mitochondria (red) are organelles found in most cells. They generate a cell's chemical energy. Credit: U. Manor, NICHD

Trypanosoma brucei is a single-cell parasite that causes sleeping sickness in humans. Scientists have been studying trypanosomes for some time because of their negative effects on human and also animal health, especially in sub-Saharan Africa. Moreover, because these organisms evolved on a separate path from those of animals and plants more than a billion years ago, researchers study trypanosomes to find out what traits they may harbor that are common to or different from those of other eukaryotes (i.e., those organisms having a nucleus and mitochondria). This image shows the T. brucei cell membrane in red, the DNA in the nucleus and kinetoplast (a structure unique to protozoans, including trypanosomes, which contains mitochondrial DNA) in blue and nuclear pore complexes (which allow molecules to pass into or out of the nucleus) in green. Scientists have found that the trypanosome nuclear pore complex has a unique mechanism by which it attaches to the nuclear envelope. In addition, the trypanosome nuclear pore complex differs from those of other eukaryotes because its components have a near-complete symmetry, and it lacks almost all of the proteins that in other eukaryotes studied so far are required to assemble the pore. To learn more why researchers study the nuclear pore complex in trypanosomes, see this press release by Rockefeller University. newswire.rockefeller.edu/2016/03/17/parasites-reveal-how-...

 

This image is not owned by the NIH. It is shared with the public under license. If you have a question about using or reproducing this image, please contact the creator listed in the credits. All rights to the work remain with the original creator.

 

Credit: Jeffery deGrasse, Rockefeller University

 

NIH funding from: National Institute of General Medical Sciences (NIGMS)

   

...featuring inner and outer membranes, luminal and matrix spaces and cristae of mitochondria from HeLa cells and also some unidetfied membranous componets.

Plus magical enchancement of lipidic components contrast achieved by adding Potassium ferrocyanide into post-fixation medium. Pure alchemy :)

 

25000x magnification, Jeol JEM-1400 electron microscope, OSIS Quemesa bottom mounted CCD.

 

Image was obtained with partial support from MSU development programm PNR5.13.

Mãng cầu Xiêm, còn gọi là mãng cầu gai, na Xiêm, na gai Mãng cầu xiêm có tên khoa học là Annona muricata thuộc họ thực vật Annonaceae. (Annona, phát xuất từ tên tại Haiti, anon, nghĩa là thu-hoạch của năm ‘muricata’ có nghĩa l à mặt bên ngoài sần lên, có những mũi nhọn).

 

Các tên thông thường: Soursop (Anh-Mỹ), Guanabana, Graviola, Brazilian Paw Paw, Corossolier (Pháp), Guanavana, Durian benggala Nangka londa.

thuộc loại tiểu mộc, có thể cao 6-8 m. Vỏ thân có nhiều lỗ nhỏ màu nâu. lá màu đậm có mùi thơm, không lông, xanh quanh năm. Hoa màu xanh, mọc ở thân. Quả mãng cầu xiêm to và có gai mềm. Thịt quả ngọt và hơi chua, hạt có màu nâu sậm. Cây mãng cầu xiêm sống ở những khu vực có độ ẩm cao và có mùa Đông không lạnh lắm, nhiệt độ dưới 5°C sẽ làm lá và các nhánh nhỏ hỏng và nhiệt độ dưới 3°C thì cây có thể chết. Cây mãng cầu xiêm được trồng làm cây ăn quả. Quả mãng cầu Xiêm nặng trung bình từ 1-2 kg có khi đến 2,5 kg, vỏ ngoài nhẵn chỉ phân biệt múi nọ với múi kia nhờ mỗi múi có một cái gai cong, mềm vì vậy còn có tên là mãng cầu gai.

Giới (regnum):

Plantae

 

(không phân hạng):Angiospermae

 

(không phân hạng)Magnoliidae

 

Bộ (ordo):

Magnoliales

 

Họ (familia):

Annonaceae

 

Chi (genus):

Annona

 

Loài (species):

A. muricata

 

Mãng cầu xiêm là một trái cây nhiệt đới rất thường gặp trong vùng Nam Mỹ và Đông Ấn (West Indies). Đây cũng là một trong những cây đầu tiên được đưa từ Mỹ châu về lục địa ‘Cựu Thế Giới’, và mãng cầu xiêm sau đó được trồng rộng rãi suốt từ khu vực Đông Nam Trung Hoa sang đến Úc và những vùng bình nguyên tại Đông và Tây Phi châu.

 

Đặc tính thực vật:

Mãng cầu xiêm thuộc loại tiểu mộc, có thể cao 6-8 m. Vỏ thân có nhiều lỗ nhỏ màu nâu. Lá hình trái xoan, thuôn thành ngọn giáo, mọc so le. Lá có mùi thơm. Phiến lá có 7-9 cặp gân phụ. Hoa mọc đơn độc ở thân hay nhánh già; hoa có 3 lá đài nhỏ màu xanh, 3 cánh ngoài màu xanh-vàng, và 3 cánh trong màu vàng. Nhị và nhụy hoa tạo thành 1 khối tròn, Trái thuộc loại trái mọng kép, lớn, hình trứng phình dài 20-25 cm, màu xanh lục hay vàng xanh, khi chín quá mức sẽ đổi sang vàng. Trái có thể kết tại nhiều vị trí khác nhau trên thân, cành hay nhánh con, và có thể cân nặng đến 5kg (15 lb). Vỏ rất mỏng, bên ngoài có những nốt phù thành những múi nhỏ nhọn hay cong, chứa nhiều hạt màu đen. Trái thường được thu hái lúc còn xanh, cứng và ăn ngon nhất vào lúc 4-5 ngày sau khi hái, lúc đó quả trở thành mềm vừa đủ để khi nhấn nhẹ ngón tay vào sẽ có một vết lõm. Phần thịt của tr ái màu trắng chia thành nhiều khối chứa hạt nhỏ.

 

Thành phần dinh dưỡng và hóa học:

 

100 gram phần thịt của trái mãng cầu xiêm, bỏ hạt, chứa:

- Calories 53.1-61.3

- Chất đạm 1 g

- Chất béo 0.97 g

- Chất sơ 0.79 g

- Calcium 10.3 mg

- Sắt 0.64 mg

- Magnesium 21 mg

- Phosphorus 27.7 mg

- Potassium 287 mg

- Sodium 14 mg

- Beta-Carotene (A) 2 IU

- Thiamine 0.110 mg

- Riboflavine 0.050 mg

- Niacin 1.280 mg

- Pantothenic acid 0.253 mg

- Pyridoxine 0.059 mg

- Vitamin C 29.6 mg

 

Lá mãng cầu xiêm chứa các acetogenins loại monotetrahydrofurane như annopentocins A, B và C; Cis và Trans-annomuricin-D-ones(4, 5), Muricoreacin, Muricohexocin… ngoài ra còn có tannin, chất nhựa resin.

 

Trái mãng cầu xiêm chứa các alkaloids loại isoquinoleine như: annonaine, nornuciferine và asimilobine.

 

Hạt chứa khoảng 0.05 % alcaloids trong đó 2 chất chính là muricin và muricinin. Nghiên cứu tại ĐH Bắc Kinh (2001) ghi nhận hạt có chứa các acetogenins: Muricatenol, Gigantetrocin-A, -B, Annomontacin, Gigante tronenin. Trong hạt còn có các hỗn hợp N-fatty acyl tryptamines, một lectin có ái lực mạnh với glucose/mannose; các galactomannans..

 

Vài phương thức sử dụng:

 

Mãng cầu xiêm được dùng làm thực phẩm tại nhiều nơi trên thế giới. Tên soursop, cho thấy quả có thể có vị chua, tuy nhiên độ chua thay đổi, tùy giống, có giống khá ngọt để ăn sống được, có giống phải ăn chung với đường. Trái chứa nhiều nước, nên thường dùng để uống hơn là ăn! Như tại Ba Tây có món Champola, tại Puerto Rico có món Carato là những thức uống theo kiểu ‘nuớc sinh tố’ ở Việt Nam: mãng cầu xay chung với sữa, nước (tại Philippines, còn pha thêm màu xanh, đỏ như sinh tố pha si-rô ở Việt Nam)

 

Mãng cầu xiêm (lá, rễ và hạt) được dùng làm thuốc tại rất nhiều nơi trên thế-giới, nhất là tại những quốc gia Nam Mỹ:

 

Tại Peru, trong vùng núi Andes, lá mãng cầu được dùng làm thuốc trị cảm, xổ mũi; hạt nghiền nát làm thuốc trừ sâu bọ; trong vùng Amazon, vỏ cây và lá dùng trị tiểu đường, làm dịu đau, chống co giật.

 

Tại Guyana: lá và vỏ cây, nấu thành trà dược giúp trị đau và bổ tim.

 

Tại Ba Tây, trong vùng Amazon: lá nấu thành trà trị bệnh gan; dầu ép từ lá và trái còn non, trộn với dầu olive làm thuốc thoa bên ngoài trị thấp khớp, đau sưng gân cốt.

 

Tại Jamaica, Haiti và West Indies: trái hay nước ép từ trái dùng trị nóng sốt, giúp sinh sữa và trị tiêu chảy; vỏ thân cây và lá dùng trị đau nhức, chống co-giật, ho, suyển.

 

Tại Ấn Độ, cây được gọi theo tiếng Tamilnadu là mullu-chitta: quả dùng chống thiếu vitamin C ( scorbut); hạt gây nôn mửa và làm se da.

 

Tại Việt Nam, hạt được dùng như hạt na, nghiền nát trong nước, lấy nước gột đầu để trị chí rận. Một phương thuốc Nam khá phổ biến để trị huyết áp cao là dùng vỏ trái hay lá mãng cầu xiêm, sắc chung với rễ nhàu và rau cần thành nước uống (bỏ bã) mỗi ngày.

Dược tính của mãng cầu xiêm:

 

Các nhà khoa học đã nghiên cứu về dược tính của mãng cầu xiêm từ 1940 và ly trích được nhiều hoạt chất. Một số các nghiên cứu sơ khởi được công bố trong khoảng thời gian 1940 đến 1962 ghi nhận vỏ thân và lá mãng cầu xiêm có những tác dụng làm hạ huyết áp, chống co giật, làm giãn nở mạch máu, thư giãn cơ trơn khi thử trên thú vật. Đến 1991, tác dụng hạ huyết áp của lá mãng cầu xiêm đã được tái xác nhận. Các nghiên cứu sau đó đã chứng minh được là dịch chiết từ lá, vỏ thân, rễ, chồi và hạt mãng cầu xiêm có những tác dụng kháng sinh chống lại một số vi khuẩn gây bệnh, và vỏ cây có khả năng chống nấm.

 

Hoạt tính của các acetogenins:

 

Trong một chương trình nghiên cứu về dược thảo của National Cancer Institute vào năm 1976, lá và chồi của mãng cầu xiêm được ghi nhận là có hoạt tính diệt các tế bào của một số loại ung thư. Hoạt tính này được cho là do ở nhóm hợp chất, đặt tên là annonaceous acetogenins

 

Các nghiên cứu về acetogenins cho thấy những chất này có khả năng ức chế rất mạnh phức hợp I (Complex I) ở trong các hệ thống chuyển vận điện tử nơi ty lạp thể (mitochondria) kể cả của tế bào ung thư [ các cây của gia đình Anonna có chứa nhiều loại acetogenins hoạt tính rất mạnh, một số có tác dụng diệt tế bào u-bướu ở nồng độ EC50 rất thấp, ngay ở 10-9 microgram/ mL.]

 

Trường Đại Học Purdue là nơi có nhiều nghiên cứu nhất về hoạt tính của gia đình Annona, giữ hàng chục bản quyền về acetogenins, và công bố khá nhiều thí nghiệm lâm sàng về tác dụng của acetogenins trên ung thư, diệt bướu ung độc:

 

Một nghiên cứu năm 1998 ghi nhận một loại acetogenin trích từ mãng cầu xiêm có tác dụng chọn lựa, diệt được tế bào ung thư ruột già loại adenocarcinoma, tác dụng này mạnh gấp 10 ngàn lần thuốc Adriamycin.

Theo các kết quả nghiên cứu tại Purdue thì: ‘các acetogenins từ annonaceae, là những acid béo có dây carbon dài từ 32-34, phối hợp với một đơn vị 2-propanol tại C-2 để tạo thành một vòng lactone. Acetogenins có những hoạt tính sinh học như chống u-bướu, kích ứng miễn nhiễm, diệt sâu bọ, chống protozoa, diệt giun sán và kháng sinh. Acetogenins là những chất ức chế rất mạnh NADH:Ubiquinone oxidoreductase, vốn là một enzym căn bản cần thiết cho complex I đưa đến phàn ứng phosphoryl-oxid hóa trong mitochondria. Acetogenins tác dụng trực tiếp vào các vị trí ubiquinone-catalytic nằm trong complex I và ngay vào men glucose dehydrogenase của vi trùng. Acetogenins cũng ức chế men ubiquinone-kết với NADH oxidase, chỉ có nơi màng plasma của tế bào ung thư.(Recent Advances in Annonaceous Acetogenins-Purdue University -1997)

 

Các acetogenins Muricoreacin và Muricohexocin có những hoạt tính diệt bào khá mạnh trên 6 loại tế bào ung thư như ung thư tiền liệt tuyền (prostate) loại adenocarcinoma (PC-3), ung thư lá lách loại carcinoma (PACA-2) (ĐH Purdue, West LaFayette, IN- trong Phytochemistry Số 49-1998)

 

Một acetogenin khác :Bullatacin có khả năng diệt được các tế bào ung thư đã kháng được nhiều thuốc dùng trong hóa-chất trị liệu, do ở hoạt tính ngăn chận sự chế tạo Adenosine triphosphate (ATP) cần thiết cho hoạt động của tế bào ung thư (Cancer Letter June 1997)

 

Các acetogenins trích từ lá Annomutacin, cùng các hợp chất loại annonacin-A-one có hoạt tính diệt được tế bào ung thư phổi dòng A-549 (Journal of Natural Products Số Tháng 9-1995)

 

Các duợc tính khác:

 

Các alkaloid: annonaine, nornuciferine và asimilobine trích được từ trái có tác dụng an thần và trị đau: Hoạt tính này do ở khả năng ức chế sự nối kết của [3H] rauwolscine vào các thụ thể 5-HT1A nằm trong phần yên của não bộ. (Journal of Pharmacy and Pharmacology Số 49-1997).

 

Dịch chiết từ trái bằng ethanol có tác dụng ức chế được siêu vi khuẩn Herpes Simplex (HSV-1) ở nồng độ 1mg/ml (Journal of Ethnophar macology Số 61-1998).

 

Các dịch chiết bằng hexane, ethyl acetate và methanol từ trái đều có những hoạt tính diệt được ký sinh trùng Leishmania braziliensis và L.panamensis (tác dụng này còn mạnh hơn cả chất Glucantime dùng làm tiêu chuẩn đối chiếu). Ngoài ra các acetogenins cô lập được annonacein, annonacin A và annomuricin A có các hoạt tính gây độc hại cho các tế bào ung thư dòng U-937 (Fitotherapia Số 71-2000).

 

Thử nghiệm tại Đại học Universidade Federal de Alagoas, Maceio-AL, Ba Tây ghi nhận dịch chiết từ lá bằng ethanol có khả năng diệt được nhuyến thể (ốc-sò) loài Biomphalaria glabrata ở nồng độ LD50 = 8.75 ppm, và có thêm đặc điểm là diệt được các tụ khối trứng của sên (Phytomedicine Số 8-2001).

 

Một lectin loại glycoproteine chứa 8% carbohydrate, ly trích từ hạt có hoạt tính kết tụ hồng huyết cầu của người, ngỗng, ngựa và gà, đồng thời ức chế được sự tăng trưởng của các nấm và mốc loại Fusarium oxysoporum, Fusarium solani và Colletotrichum musae (Journal of Protein Chemistry Số 22-2003)

 

Mãng cầu xiêm có liên hệ với bệnh Parkinson:

 

Tại vùng West Indies thuộc Pháp, nhất là ở Guadaloupe có tình trạng xảy ra bất thường về con số các bệnh nhân bị bệnh Parkinson, loại kháng-levo dopa: những bệnh nhân này đều tiêu thụ một lượng cao, và trong một thời gian lâu dài soursop hay mãng cầu xiêm (A.muricata).

 

Những nghiên cứu sơ khởi trong năm 1999 (công bố trên tạp chí Lancet Số 354, ngày 23 tháng 10 năm 1999) trên 87 bệnh nhân đưa đến kết luận là rất có thể có sự liên hệ giữa dùng nhiều mãng cầu xiêm, vốn có chứa các alkaloids loại benzyltetrahydroisoquinoleine độc hại về thần kinh. Nhóm bệnh nhân có những triệu chứng Parkinson không chuyên biệt (atipycal), gồm 30 người dùng khá nhiều mãng cầu trong cách ăn uống hàng ngày.

 

Nghiên cứu sâu rộng hơn vào năm 2002, cũng tại Guadeloupe, nhằm vào nhóm bệnh nhân Parkinson (atypical) cho thấy khi tách riêng các tế bào thần kinh (neuron) loại mesencephalic dopaminergic và cấy trong môi trường có chứa dịch chiết toàn phần rễ mãng cầu xiêm, hoặc chứa các hoạt chất cô lập như coreximinine, reticuline, có các kết quả như sau: Sau 24 giờ tiếp xúc: 50% các tế bào thần kinh cấy bị suy thoái ở nồng độ 18 microg/ml dịch chiết toàn phần; 4.3 microg/ml coreximine và 100 microg/ml reticuline.

 

Nghiên cứu này đưa đến kết luận là những alkaloids trích từ mãng cầu xiêm có thể có tác dụng điều hợp chức năng cùng sự thay đổi để sinh tồn của các tế bào thần kinh dopaminergic trong các thử nghiệm ‘in vitro’; và rất có thể có những liên hệ tác hại giữa việc dùng mãng cầu xiêm ở lượng cao và liên tục với những suy thoái về tế bào thần kinh. Do đó bệnh nhân Parkinson, do yếu tố an toàn nên tránh ăn mãng cầu xiêm! (Movement Disorders Số 17-2002).

 

Độc tính và liều lượng:

 

Theo tài liệu của Herbal Secrets of the Rain Forest:

Liều trị liệu của lá (cũng chứa lượng acetrogenins khá cao, so với rễ và hạt) là 2-3 gram chia làm 3-4 lần/ngày. Trên thị trường Hoa Kỳ có một số chế phẩm, mang tên Graviola, dưới các dạng viên nang (capsule) và cồn thuốc (tincture).

  

Không nên dùng các chế phẩm làm từ lá, rễ và hạt mãng cầu xiêm (phần thịt của quả không bị hạn chế) trong các trường hợp:

 

- Có thai: do hoạt tính gây co tht tử cung khi thử trên chuột.

- Huyết áp cao: Lá, rễ và ht có tác dụng gây hạ huyết áp, ức chế tim, người dùng thuốc trị áp huyết cần bàn với BS điều trị.

- Khi dùng lâu dài các chế phẩ;m Graviola có thể gây các rối loạn về vi sinh vật trong đường ruột.

- Một số trường h&##7907;p bị ói mửa, buồn nôn khi dùng Graviola, trong trường hợp này nên giảm bớt liều sử dụng.

- Không nên dùng Graviola chung với CoEnzyme Q 10 (một trong những cơ chế hoạt động của acetogenins là ngăn chặn sự cung cấp ATP cho tế bào ung thư, và CoEnzym Q.10 là một chất cung cấp ATP), uống chung sẽ làm giảm công hiệu của cả 2 loại.

   

Annona muricata is a member of the family of Custard apple trees called Annonaceae and a species of the genus Annona known mostly for its edible fruits Anona. Annona muricata produces fruits that are usually called Soursop due to its slightly acidic taste when ripe. A. muricata trees grew natively in the Caribbean and Central America but are now widely cultivated and in some areas, escaping and living on their own in tropical climates throughout the world.

Common names

•English: Brazilian pawpaw, soursop, prickly custard apple, Soursapi

•Spanish: guanábana, guanábano, anona, catche, catoche, catuche, zapote agrio

•Chamorro: laguaná, laguana, laguanaha, syasyap

•German: Sauersack, Stachelannone, anona, flashendaum, stachel anone, stachliger

•Fijian: sarifa, seremaia

•French: anone muriquee, cachiman épineux, corossol épineux,anone, cachiman épineux, caichemantier, coeur de boeuf, corossol, corossolier, epineux

•Indonesian: sirsak

•Malay: Durian Belanda

•Māori: kātara‘apa, kātara‘apa papa‘ā, naponapo taratara

•Dutch: zuurzak

•Portuguese: graviola, araticum-grande, araticum-manso, coração-de-rainha, jaca-de-pobre, jaca-do-Pará, anona, curassol, graviola, pinha azeda

•Samoan: sanalapa, sasalapa, sasalapa

•Tahitian: tapotapo papa‘a, tapotapo urupe

•Vietnamese: mãng cầu Xiêm, mãng cầu gai

•Chinese: 刺果番荔枝

Description

Annona muricata is a small, upright, evergreen that can grow to about 4 metres (13 ft) tall and cannot stand frost.

Stems and leaves

The young branches are hairy.

Leaves are oblong to oval, 8 centimetres (3.1 in) to 16 centimetres (6.3 in) long and 3 centimetres (1.2 in) to 7 centimetres (2.8 in) wide. Glossy dark green with no hairs above, paler and minutely hairy to no hairs below.

The leaf stalks are 4 millimetres (0.16 in) to 13 millimetres (0.51 in) long and without hairs.

Flowers

Flower stalks (peduncles) are 2 millimetres (0.079 in) to 5 millimetres (0.20 in) long and woody. They appear opposite from the leaves or as an extra from near the leaf stalk, each with one or two flowers, occasionally a third.

Stalks for the individual flowers (pedicels) are stout and woody, minutely hairy to hairless and 15 millimetres (0.59 in) to 20 millimetres (0.79 in) with small bractlets nearer to the base which are densely hairy.

Petals are thick and yellowish. Outer petals meet at the edges without overlapping and are broadly ovate, 2.8 centimetres (1.1 in) to 3.3 centimetres (1.3 in) by 2.1 centimetres (0.83 in) to 2.5 centimetres (0.98 in), tapering to a point with a heart shaped base. Evenly thick, covered with long, slender, soft hairs externally and matted finely with soft hairs within. Inner petals are oval shaped and overlap. 2.5 centimetres (0.98 in) to 2.8 centimetres (1.1 in) by 2 centimetres (0.79 in). Sharply angled and tapering at the base. Margins are comparatively thin, with fine matted soft hairs on both sides. The receptacle is conical and hairy. Stamens 4.5 millimetres (0.18 in) long and narrowly wedge-shaped. The connective-tip terminate abruptly and anther hollows are unequal. Sepals are quite thick and do not overlap. Carpels are linear and basally growing from one base. The ovaries are covered with dense reddish brown hairs, 1-ovuled, style short and stigma truncate.

Fruits and reproduction

Dark green, prickly (or bristled) fruits are egg-shaped and can be up to 30 centimetres (12 in) long, with a moderately firm texture.[5] Flesh is juicy, acid, whitish and aromatic.

Abundant seeds the average weight of 1000 fresh seeds is 470 grams (17 oz) and had an average oil content of 24%. When dried for 3 days in 60 °C (140 °F) the average seed weight was 322 grams (11.4 oz) and were tolerant of the moisture extraction; showing no problems for long-term storage under reasonable conditions.

Distribution

Annona muricata is tolerant of poor soil and prefers lowland areas between the altitudes of 0 metres (0 ft) to 1,200 metres (3,900 ft).

Native

Neotropic:

Caribbean: Cuba, Jamaica, Trinidad and Tobago, Haiti, Puerto Rico

Central America: Costa Rica, El Salvador, Guatemala, Honduras, Mexico, Nicaragua, Panama, Belize

South America: Bolivia, Colombia, Venezuela, Ecuador[4

  

Mãng cầu Xiêm, còn gọi là mãng cầu gai, na Xiêm, na gai Mãng cầu xiêm có tên khoa học là Annona muricata thuộc họ thực vật Annonaceae. (Annona, phát xuất từ tên tại Haiti, anon, nghĩa là thu-hoạch của năm ‘muricata’ có nghĩa l à mặt bên ngoài sần lên, có những mũi nhọn).

 

Các tên thông thường: Soursop (Anh-Mỹ), Guanabana, Graviola, Brazilian Paw Paw, Corossolier (Pháp), Guanavana, Durian benggala Nangka londa.

thuộc loại tiểu mộc, có thể cao 6-8 m. Vỏ thân có nhiều lỗ nhỏ màu nâu. lá màu đậm có mùi thơm, không lông, xanh quanh năm. Hoa màu xanh, mọc ở thân. Quả mãng cầu xiêm to và có gai mềm. Thịt quả ngọt và hơi chua, hạt có màu nâu sậm. Cây mãng cầu xiêm sống ở những khu vực có độ ẩm cao và có mùa Đông không lạnh lắm, nhiệt độ dưới 5°C sẽ làm lá và các nhánh nhỏ hỏng và nhiệt độ dưới 3°C thì cây có thể chết. Cây mãng cầu xiêm được trồng làm cây ăn quả. Quả mãng cầu Xiêm nặng trung bình từ 1-2 kg có khi đến 2,5 kg, vỏ ngoài nhẵn chỉ phân biệt múi nọ với múi kia nhờ mỗi múi có một cái gai cong, mềm vì vậy còn có tên là mãng cầu gai.

Giới (regnum):

Plantae

 

(không phân hạng):Angiospermae

 

(không phân hạng)Magnoliidae

 

Bộ (ordo):

Magnoliales

 

Họ (familia):

Annonaceae

 

Chi (genus):

Annona

 

Loài (species):

A. muricata

 

Mãng cầu xiêm là một trái cây nhiệt đới rất thường gặp trong vùng Nam Mỹ và Đông Ấn (West Indies). Đây cũng là một trong những cây đầu tiên được đưa từ Mỹ châu về lục địa ‘Cựu Thế Giới’, và mãng cầu xiêm sau đó được trồng rộng rãi suốt từ khu vực Đông Nam Trung Hoa sang đến Úc và những vùng bình nguyên tại Đông và Tây Phi châu.

 

Đặc tính thực vật:

Mãng cầu xiêm thuộc loại tiểu mộc, có thể cao 6-8 m. Vỏ thân có nhiều lỗ nhỏ màu nâu. Lá hình trái xoan, thuôn thành ngọn giáo, mọc so le. Lá có mùi thơm. Phiến lá có 7-9 cặp gân phụ. Hoa mọc đơn độc ở thân hay nhánh già; hoa có 3 lá đài nhỏ màu xanh, 3 cánh ngoài màu xanh-vàng, và 3 cánh trong màu vàng. Nhị và nhụy hoa tạo thành 1 khối tròn, Trái thuộc loại trái mọng kép, lớn, hình trứng phình dài 20-25 cm, màu xanh lục hay vàng xanh, khi chín quá mức sẽ đổi sang vàng. Trái có thể kết tại nhiều vị trí khác nhau trên thân, cành hay nhánh con, và có thể cân nặng đến 5kg (15 lb). Vỏ rất mỏng, bên ngoài có những nốt phù thành những múi nhỏ nhọn hay cong, chứa nhiều hạt màu đen. Trái thường được thu hái lúc còn xanh, cứng và ăn ngon nhất vào lúc 4-5 ngày sau khi hái, lúc đó quả trở thành mềm vừa đủ để khi nhấn nhẹ ngón tay vào sẽ có một vết lõm. Phần thịt của tr ái màu trắng chia thành nhiều khối chứa hạt nhỏ.

 

Thành phần dinh dưỡng và hóa học:

 

100 gram phần thịt của trái mãng cầu xiêm, bỏ hạt, chứa:

- Calories 53.1-61.3

- Chất đạm 1 g

- Chất béo 0.97 g

- Chất sơ 0.79 g

- Calcium 10.3 mg

- Sắt 0.64 mg

- Magnesium 21 mg

- Phosphorus 27.7 mg

- Potassium 287 mg

- Sodium 14 mg

- Beta-Carotene (A) 2 IU

- Thiamine 0.110 mg

- Riboflavine 0.050 mg

- Niacin 1.280 mg

- Pantothenic acid 0.253 mg

- Pyridoxine 0.059 mg

- Vitamin C 29.6 mg

 

Lá mãng cầu xiêm chứa các acetogenins loại monotetrahydrofurane như annopentocins A, B và C; Cis và Trans-annomuricin-D-ones(4, 5), Muricoreacin, Muricohexocin… ngoài ra còn có tannin, chất nhựa resin.

 

Trái mãng cầu xiêm chứa các alkaloids loại isoquinoleine như: annonaine, nornuciferine và asimilobine.

 

Hạt chứa khoảng 0.05 % alcaloids trong đó 2 chất chính là muricin và muricinin. Nghiên cứu tại ĐH Bắc Kinh (2001) ghi nhận hạt có chứa các acetogenins: Muricatenol, Gigantetrocin-A, -B, Annomontacin, Gigante tronenin. Trong hạt còn có các hỗn hợp N-fatty acyl tryptamines, một lectin có ái lực mạnh với glucose/mannose; các galactomannans..

 

Vài phương thức sử dụng:

 

Mãng cầu xiêm được dùng làm thực phẩm tại nhiều nơi trên thế giới. Tên soursop, cho thấy quả có thể có vị chua, tuy nhiên độ chua thay đổi, tùy giống, có giống khá ngọt để ăn sống được, có giống phải ăn chung với đường. Trái chứa nhiều nước, nên thường dùng để uống hơn là ăn! Như tại Ba Tây có món Champola, tại Puerto Rico có món Carato là những thức uống theo kiểu ‘nuớc sinh tố’ ở Việt Nam: mãng cầu xay chung với sữa, nước (tại Philippines, còn pha thêm màu xanh, đỏ như sinh tố pha si-rô ở Việt Nam)

 

Mãng cầu xiêm (lá, rễ và hạt) được dùng làm thuốc tại rất nhiều nơi trên thế-giới, nhất là tại những quốc gia Nam Mỹ:

 

Tại Peru, trong vùng núi Andes, lá mãng cầu được dùng làm thuốc trị cảm, xổ mũi; hạt nghiền nát làm thuốc trừ sâu bọ; trong vùng Amazon, vỏ cây và lá dùng trị tiểu đường, làm dịu đau, chống co giật.

 

Tại Guyana: lá và vỏ cây, nấu thành trà dược giúp trị đau và bổ tim.

 

Tại Ba Tây, trong vùng Amazon: lá nấu thành trà trị bệnh gan; dầu ép từ lá và trái còn non, trộn với dầu olive làm thuốc thoa bên ngoài trị thấp khớp, đau sưng gân cốt.

 

Tại Jamaica, Haiti và West Indies: trái hay nước ép từ trái dùng trị nóng sốt, giúp sinh sữa và trị tiêu chảy; vỏ thân cây và lá dùng trị đau nhức, chống co-giật, ho, suyển.

 

Tại Ấn Độ, cây được gọi theo tiếng Tamilnadu là mullu-chitta: quả dùng chống thiếu vitamin C ( scorbut); hạt gây nôn mửa và làm se da.

 

Tại Việt Nam, hạt được dùng như hạt na, nghiền nát trong nước, lấy nước gột đầu để trị chí rận. Một phương thuốc Nam khá phổ biến để trị huyết áp cao là dùng vỏ trái hay lá mãng cầu xiêm, sắc chung với rễ nhàu và rau cần thành nước uống (bỏ bã) mỗi ngày.

Dược tính của mãng cầu xiêm:

 

Các nhà khoa học đã nghiên cứu về dược tính của mãng cầu xiêm từ 1940 và ly trích được nhiều hoạt chất. Một số các nghiên cứu sơ khởi được công bố trong khoảng thời gian 1940 đến 1962 ghi nhận vỏ thân và lá mãng cầu xiêm có những tác dụng làm hạ huyết áp, chống co giật, làm giãn nở mạch máu, thư giãn cơ trơn khi thử trên thú vật. Đến 1991, tác dụng hạ huyết áp của lá mãng cầu xiêm đã được tái xác nhận. Các nghiên cứu sau đó đã chứng minh được là dịch chiết từ lá, vỏ thân, rễ, chồi và hạt mãng cầu xiêm có những tác dụng kháng sinh chống lại một số vi khuẩn gây bệnh, và vỏ cây có khả năng chống nấm.

 

Hoạt tính của các acetogenins:

 

Trong một chương trình nghiên cứu về dược thảo của National Cancer Institute vào năm 1976, lá và chồi của mãng cầu xiêm được ghi nhận là có hoạt tính diệt các tế bào của một số loại ung thư. Hoạt tính này được cho là do ở nhóm hợp chất, đặt tên là annonaceous acetogenins

 

Các nghiên cứu về acetogenins cho thấy những chất này có khả năng ức chế rất mạnh phức hợp I (Complex I) ở trong các hệ thống chuyển vận điện tử nơi ty lạp thể (mitochondria) kể cả của tế bào ung thư [ các cây của gia đình Anonna có chứa nhiều loại acetogenins hoạt tính rất mạnh, một số có tác dụng diệt tế bào u-bướu ở nồng độ EC50 rất thấp, ngay ở 10-9 microgram/ mL.]

 

Trường Đại Học Purdue là nơi có nhiều nghiên cứu nhất về hoạt tính của gia đình Annona, giữ hàng chục bản quyền về acetogenins, và công bố khá nhiều thí nghiệm lâm sàng về tác dụng của acetogenins trên ung thư, diệt bướu ung độc:

 

Một nghiên cứu năm 1998 ghi nhận một loại acetogenin trích từ mãng cầu xiêm có tác dụng chọn lựa, diệt được tế bào ung thư ruột già loại adenocarcinoma, tác dụng này mạnh gấp 10 ngàn lần thuốc Adriamycin.

Theo các kết quả nghiên cứu tại Purdue thì: ‘các acetogenins từ annonaceae, là những acid béo có dây carbon dài từ 32-34, phối hợp với một đơn vị 2-propanol tại C-2 để tạo thành một vòng lactone. Acetogenins có những hoạt tính sinh học như chống u-bướu, kích ứng miễn nhiễm, diệt sâu bọ, chống protozoa, diệt giun sán và kháng sinh. Acetogenins là những chất ức chế rất mạnh NADH:Ubiquinone oxidoreductase, vốn là một enzym căn bản cần thiết cho complex I đưa đến phàn ứng phosphoryl-oxid hóa trong mitochondria. Acetogenins tác dụng trực tiếp vào các vị trí ubiquinone-catalytic nằm trong complex I và ngay vào men glucose dehydrogenase của vi trùng. Acetogenins cũng ức chế men ubiquinone-kết với NADH oxidase, chỉ có nơi màng plasma của tế bào ung thư.(Recent Advances in Annonaceous Acetogenins-Purdue University -1997)

 

Các acetogenins Muricoreacin và Muricohexocin có những hoạt tính diệt bào khá mạnh trên 6 loại tế bào ung thư như ung thư tiền liệt tuyền (prostate) loại adenocarcinoma (PC-3), ung thư lá lách loại carcinoma (PACA-2) (ĐH Purdue, West LaFayette, IN- trong Phytochemistry Số 49-1998)

 

Một acetogenin khác :Bullatacin có khả năng diệt được các tế bào ung thư đã kháng được nhiều thuốc dùng trong hóa-chất trị liệu, do ở hoạt tính ngăn chận sự chế tạo Adenosine triphosphate (ATP) cần thiết cho hoạt động của tế bào ung thư (Cancer Letter June 1997)

 

Các acetogenins trích từ lá Annomutacin, cùng các hợp chất loại annonacin-A-one có hoạt tính diệt được tế bào ung thư phổi dòng A-549 (Journal of Natural Products Số Tháng 9-1995)

 

Các duợc tính khác:

 

Các alkaloid: annonaine, nornuciferine và asimilobine trích được từ trái có tác dụng an thần và trị đau: Hoạt tính này do ở khả năng ức chế sự nối kết của [3H] rauwolscine vào các thụ thể 5-HT1A nằm trong phần yên của não bộ. (Journal of Pharmacy and Pharmacology Số 49-1997).

 

Dịch chiết từ trái bằng ethanol có tác dụng ức chế được siêu vi khuẩn Herpes Simplex (HSV-1) ở nồng độ 1mg/ml (Journal of Ethnophar macology Số 61-1998).

 

Các dịch chiết bằng hexane, ethyl acetate và methanol từ trái đều có những hoạt tính diệt được ký sinh trùng Leishmania braziliensis và L.panamensis (tác dụng này còn mạnh hơn cả chất Glucantime dùng làm tiêu chuẩn đối chiếu). Ngoài ra các acetogenins cô lập được annonacein, annonacin A và annomuricin A có các hoạt tính gây độc hại cho các tế bào ung thư dòng U-937 (Fitotherapia Số 71-2000).

 

Thử nghiệm tại Đại học Universidade Federal de Alagoas, Maceio-AL, Ba Tây ghi nhận dịch chiết từ lá bằng ethanol có khả năng diệt được nhuyến thể (ốc-sò) loài Biomphalaria glabrata ở nồng độ LD50 = 8.75 ppm, và có thêm đặc điểm là diệt được các tụ khối trứng của sên (Phytomedicine Số 8-2001).

 

Một lectin loại glycoproteine chứa 8% carbohydrate, ly trích từ hạt có hoạt tính kết tụ hồng huyết cầu của người, ngỗng, ngựa và gà, đồng thời ức chế được sự tăng trưởng của các nấm và mốc loại Fusarium oxysoporum, Fusarium solani và Colletotrichum musae (Journal of Protein Chemistry Số 22-2003)

 

Mãng cầu xiêm có liên hệ với bệnh Parkinson:

 

Tại vùng West Indies thuộc Pháp, nhất là ở Guadaloupe có tình trạng xảy ra bất thường về con số các bệnh nhân bị bệnh Parkinson, loại kháng-levo dopa: những bệnh nhân này đều tiêu thụ một lượng cao, và trong một thời gian lâu dài soursop hay mãng cầu xiêm (A.muricata).

 

Những nghiên cứu sơ khởi trong năm 1999 (công bố trên tạp chí Lancet Số 354, ngày 23 tháng 10 năm 1999) trên 87 bệnh nhân đưa đến kết luận là rất có thể có sự liên hệ giữa dùng nhiều mãng cầu xiêm, vốn có chứa các alkaloids loại benzyltetrahydroisoquinoleine độc hại về thần kinh. Nhóm bệnh nhân có những triệu chứng Parkinson không chuyên biệt (atipycal), gồm 30 người dùng khá nhiều mãng cầu trong cách ăn uống hàng ngày.

 

Nghiên cứu sâu rộng hơn vào năm 2002, cũng tại Guadeloupe, nhằm vào nhóm bệnh nhân Parkinson (atypical) cho thấy khi tách riêng các tế bào thần kinh (neuron) loại mesencephalic dopaminergic và cấy trong môi trường có chứa dịch chiết toàn phần rễ mãng cầu xiêm, hoặc chứa các hoạt chất cô lập như coreximinine, reticuline, có các kết quả như sau: Sau 24 giờ tiếp xúc: 50% các tế bào thần kinh cấy bị suy thoái ở nồng độ 18 microg/ml dịch chiết toàn phần; 4.3 microg/ml coreximine và 100 microg/ml reticuline.

 

Nghiên cứu này đưa đến kết luận là những alkaloids trích từ mãng cầu xiêm có thể có tác dụng điều hợp chức năng cùng sự thay đổi để sinh tồn của các tế bào thần kinh dopaminergic trong các thử nghiệm ‘in vitro’; và rất có thể có những liên hệ tác hại giữa việc dùng mãng cầu xiêm ở lượng cao và liên tục với những suy thoái về tế bào thần kinh. Do đó bệnh nhân Parkinson, do yếu tố an toàn nên tránh ăn mãng cầu xiêm! (Movement Disorders Số 17-2002).

 

Độc tính và liều lượng:

 

Theo tài liệu của Herbal Secrets of the Rain Forest:

Liều trị liệu của lá (cũng chứa lượng acetrogenins khá cao, so với rễ và hạt) là 2-3 gram chia làm 3-4 lần/ngày. Trên thị trường Hoa Kỳ có một số chế phẩm, mang tên Graviola, dưới các dạng viên nang (capsule) và cồn thuốc (tincture).

  

Không nên dùng các chế phẩm làm từ lá, rễ và hạt mãng cầu xiêm (phần thịt của quả không bị hạn chế) trong các trường hợp:

 

- Có thai: do hoạt tính gây co tht tử cung khi thử trên chuột.

- Huyết áp cao: Lá, rễ và ht có tác dụng gây hạ huyết áp, ức chế tim, người dùng thuốc trị áp huyết cần bàn với BS điều trị.

- Khi dùng lâu dài các chế phẩ;m Graviola có thể gây các rối loạn về vi sinh vật trong đường ruột.

- Một số trường h&##7907;p bị ói mửa, buồn nôn khi dùng Graviola, trong trường hợp này nên giảm bớt liều sử dụng.

- Không nên dùng Graviola chung với CoEnzyme Q 10 (một trong những cơ chế hoạt động của acetogenins là ngăn chặn sự cung cấp ATP cho tế bào ung thư, và CoEnzym Q.10 là một chất cung cấp ATP), uống chung sẽ làm giảm công hiệu của cả 2 loại.

   

Annona muricata is a member of the family of Custard apple trees called Annonaceae and a species of the genus Annona known mostly for its edible fruits Anona. Annona muricata produces fruits that are usually called Soursop due to its slightly acidic taste when ripe. A. muricata trees grew natively in the Caribbean and Central America but are now widely cultivated and in some areas, escaping and living on their own in tropical climates throughout the world.

Common names

•English: Brazilian pawpaw, soursop, prickly custard apple, Soursapi

•Spanish: guanábana, guanábano, anona, catche, catoche, catuche, zapote agrio

•Chamorro: laguaná, laguana, laguanaha, syasyap

•German: Sauersack, Stachelannone, anona, flashendaum, stachel anone, stachliger

•Fijian: sarifa, seremaia

•French: anone muriquee, cachiman épineux, corossol épineux,anone, cachiman épineux, caichemantier, coeur de boeuf, corossol, corossolier, epineux

•Indonesian: sirsak

•Malay: Durian Belanda

•Māori: kātara‘apa, kātara‘apa papa‘ā, naponapo taratara

•Dutch: zuurzak

•Portuguese: graviola, araticum-grande, araticum-manso, coração-de-rainha, jaca-de-pobre, jaca-do-Pará, anona, curassol, graviola, pinha azeda

•Samoan: sanalapa, sasalapa, sasalapa

•Tahitian: tapotapo papa‘a, tapotapo urupe

•Vietnamese: mãng cầu Xiêm, mãng cầu gai

•Chinese: 刺果番荔枝

Description

Annona muricata is a small, upright, evergreen that can grow to about 4 metres (13 ft) tall and cannot stand frost.

Stems and leaves

The young branches are hairy.

Leaves are oblong to oval, 8 centimetres (3.1 in) to 16 centimetres (6.3 in) long and 3 centimetres (1.2 in) to 7 centimetres (2.8 in) wide. Glossy dark green with no hairs above, paler and minutely hairy to no hairs below.

The leaf stalks are 4 millimetres (0.16 in) to 13 millimetres (0.51 in) long and without hairs.

Flowers

Flower stalks (peduncles) are 2 millimetres (0.079 in) to 5 millimetres (0.20 in) long and woody. They appear opposite from the leaves or as an extra from near the leaf stalk, each with one or two flowers, occasionally a third.

Stalks for the individual flowers (pedicels) are stout and woody, minutely hairy to hairless and 15 millimetres (0.59 in) to 20 millimetres (0.79 in) with small bractlets nearer to the base which are densely hairy.

Petals are thick and yellowish. Outer petals meet at the edges without overlapping and are broadly ovate, 2.8 centimetres (1.1 in) to 3.3 centimetres (1.3 in) by 2.1 centimetres (0.83 in) to 2.5 centimetres (0.98 in), tapering to a point with a heart shaped base. Evenly thick, covered with long, slender, soft hairs externally and matted finely with soft hairs within. Inner petals are oval shaped and overlap. 2.5 centimetres (0.98 in) to 2.8 centimetres (1.1 in) by 2 centimetres (0.79 in). Sharply angled and tapering at the base. Margins are comparatively thin, with fine matted soft hairs on both sides. The receptacle is conical and hairy. Stamens 4.5 millimetres (0.18 in) long and narrowly wedge-shaped. The connective-tip terminate abruptly and anther hollows are unequal. Sepals are quite thick and do not overlap. Carpels are linear and basally growing from one base. The ovaries are covered with dense reddish brown hairs, 1-ovuled, style short and stigma truncate.

Fruits and reproduction

Dark green, prickly (or bristled) fruits are egg-shaped and can be up to 30 centimetres (12 in) long, with a moderately firm texture.[5] Flesh is juicy, acid, whitish and aromatic.

Abundant seeds the average weight of 1000 fresh seeds is 470 grams (17 oz) and had an average oil content of 24%. When dried for 3 days in 60 °C (140 °F) the average seed weight was 322 grams (11.4 oz) and were tolerant of the moisture extraction; showing no problems for long-term storage under reasonable conditions.

Distribution

Annona muricata is tolerant of poor soil and prefers lowland areas between the altitudes of 0 metres (0 ft) to 1,200 metres (3,900 ft).

Native

Neotropic:

Caribbean: Cuba, Jamaica, Trinidad and Tobago, Haiti, Puerto Rico

Central America: Costa Rica, El Salvador, Guatemala, Honduras, Mexico, Nicaragua, Panama, Belize

South America: Bolivia, Colombia, Venezuela, Ecuador[4

  

The bar-headed goose (Anser indicus) is a goose that breeds in Central Asia in colonies of thousands near mountain lakes and winters in South Asia, as far south as peninsular India. It lays three to eight eggs at a time in a ground nest. It is known for the extreme altitudes it reaches when migrating across the Himalayas.

 

Taxonomy

The grey goose genus Anser has no other member indigenous to the Indian region, nor any at all to the Ethiopian, Australian, or Neotropical regions. Ludwig Reichenbach placed the bar-headed goose in the monotypic genus Eulabeia in 1852, though John Boyd's taxonomy treats both Eulabeia and the genus Chen as subgenera of Anser.

 

Description

The bird is pale grey and is easily distinguished from any of the other grey geese of the genus Anser by the black bars on its head. It is also much paler than the other geese in this genus. In flight, its call is a typical goose honking. A mid-sized goose, it measures 71–76 cm (28–30 in) in total length and weighs 1.87–3.2 kg (4.1–7.1 lb).

 

Ecology

The summer habitat is high-altitude lakes where the bird grazes on short grass. The species has been reported as migrating south from Tibet, Kazakhstan, Mongolia and Russia before crossing the Himalayas. The bird has come to the attention of medical science in recent years as having been an early victim of the H5N1 virus, HPAI (highly pathogenic avian influenza), at Qinghai. It suffers predation from crows, foxes, ravens, sea eagles, gulls and others. The total population may, however, be increasing, but it is complex to assess population trends, as this species occurs over more than 2,500,000 km2 (970,000 sq mi).

 

The bar-headed goose is one of the world's highest-flying birds, having been heard flying across Mount Makalu – the fifth highest mountain on earth at 8,481 m (27,825 ft) – and apparently seen over Mount Everest – 8,848 m (29,029 ft) – although this is a second-hand report with no verification. This demanding migration has long puzzled physiologists and naturalists: "there must be a good explanation for why the birds fly to the extreme altitudes... particularly since there are passes through the Himalaya at lower altitudes, and which are used by other migrating bird species." In fact, bar-headed geese had for a long time not been directly tracked (using GPS or satellite logging technology) flying higher than 6,540 metres (21,460 ft), and it is now believed that they do take the high passes through the mountains. The challenging northward migration from lowland India to breed in the summer on the Tibetan Plateau is undertaken in stages, with the flight across the Himalaya (from sea-level) being undertaken non-stop in as little as seven hours. Surprisingly, despite predictable tail winds that blow up the Himalayas (in the same direction of travel as the geese), bar-headed geese spurn these winds, waiting for them to die down overnight, when they then undertake the greatest rates of climbing flight ever recorded for a bird, and sustain these climbs rates for hours on end, according to research published in 2011.

 

The 2011 study found the geese peaking at an altitude of around 6,400 m (21,000 ft). In a 2012 study that tagged 91 geese and tracked their migration routes, it was determined that the geese spent 95% of their time below 5,784 m (18,976 ft), choosing to take a longer route through the Himalayas in order to utilize lower-altitude valleys and passes. Only 10 of the tagged geese were ever recorded above this altitude, and only one exceeded 6,500 m (21,300 ft), reaching 7,290 m (23,920 ft). All but one of these high-altitude flights were recorded at night, which along with the early morning, is the most common time of day for geese migration. The colder denser air during these times may be equivalent to an altitude hundreds of meters lower. It is suspected by the authors of these two studies that tales of the geese flying at 8,000 m (26,000 ft) are apocryphal.[8] Bar headed geese have been observed flying at 7,000 metres (23,000 ft).

 

The bar-headed goose migrates over the Himalayas to spend the winter in parts of South Asia (from Assam to as far south as Tamil Nadu. The modern winter habitat of the species is cultivated fields, where it feeds on barley, rice and wheat, and may damage crops. Birds from Kyrgyzstan have been seen to stopover in western Tibet and southern Tajikistan for 20 to 30 days before migrating farther south. Some birds may show high wintering site fidelity.

 

They nest mainly on the Tibetan Plateau. Intraspecific brood parasitism is noticed with lower rank females attempting to lay their eggs in the nests of higher ranking females.

 

The bar-headed goose is often kept in captivity, as it is considered beautiful and breeds readily. Recorded sightings in Great Britain are frequent, and almost certainly relate to escapes. However, the species has bred on several occasions in recent years, and around five pairs were recorded in 2002, the most recent available report of the Rare Birds Breeding Panel. It is possible that, owing to a combination of frequent migration, accidental escapes and deliberate introduction, the species is becoming gradually more established in Great Britain.

 

The bar-headed goose has escaped or been deliberately released in Florida, U.S., but there is no evidence that the population is breeding and it may only persist due to continuing escapes or releases.

 

Physiology and morphology

The main physiological challenge of bar-headed geese is extracting oxygen from hypoxic air and transporting it to aerobic muscle fibres in order to sustain flight at high altitudes. Flight is very metabolically costly at high-altitudes because birds need to flap harder in thin air to generate lift. Studies have found that bar-headed geese breathe more deeply and efficiently under low-oxygen conditions, which serves to increase oxygen uptake from the environment. The haemoglobin of their blood has a higher affinity for oxygen than that of low-altitude geese, which has been attributed to a single amino acid point mutation. This mutation causes a conformational shift in the haemoglobin molecule from the low-oxygen to the high-oxygen affinity form. The left-ventricle of the heart, which is responsible for pumping oxygenated blood to the body via systemic circulation, has significantly more capillaries in bar-headed geese than in lowland birds, maintaining oxygenation of cardiac muscle cells and thereby cardiac output. Compared to lowland birds, mitochondria (the main site of oxygen consumption) in the flight muscle of bar-headed geese are significantly closer to the sarcolemma, decreasing the intracellular diffusion distance of oxygen from the capillaries to the mitochondria.

 

Bar-headed geese have a slightly larger wing area for their weight than other geese, which is believed to help them fly at high altitudes. While this decreases the power output required for flight in thin air, birds at high altitude still need to flap harder than lowland birds.

 

Cultural depiction

The bar-headed goose has been suggested as being the model for the Hamsa of Indian mythology. Another interpretation suggests that the bar-headed goose is likely to be the Kadamb in ancient and medieval Sanskrit literature, whereas Hamsa generally refers to the swan.

Old human fibroblasts showing their mitochondria in large branched networks (in red), their nuclear DNA (in blue) and sites of DNA damage (in green).

Since my parents have also gone through the 23andMe DNA analysis, we can compare genes.

 

Thanks for the endurance mom! For those who know her, this is a strong point. =)

 

The genome-wide comparison above covers almost a million SNPs (Single Nucleotide Polymorphisms), which are point letter mutations (like A → G or T → C swaps) that have accumulated in relatively recent generations and vary across the peoples of the planet.

 

For each of the traits, I added a note with explanatory text from 23andMe. For example, the 135 SNPs related to endurance cover “genes that have been associated with different endurance phenotypes, including VO2max (your maximum capacity to transport and utilize oxygen), running distance, exercise time, and power output.”

 

Immune System Compatibility is also pretty interesting as it is almost entirely genetic, and relates to organ transplant potential and mate preference (we have a natural aversion to people with immune systems too similar to our own). Whew!

 

The analysis above is on the 22 autosomal chromosomes which are a blend from mom and dad. To look at a segment of DNA that we know only came from Mom, we look at the mitochondrial DNA (mtDNA) which is outside the nucleus and resident in each of the mitochondria, or “power plants” of our cells. When you were a single cell, that cell came from mom. Dad’s genetic contribution went straight to the nucleus. And as that cell proceeded to divide, the mtDNA was copied as well, now replicated in all of the cells of your body, and entirely derived from mom. The sperm’s mitochondria are mainly in the tail, and the egg cell destroys any that might make it across. And it is abundant. Your liver cells, for example, have about 1500 mitochondria and about 10 thousand copies of mom’s mtDNA per cell.

 

By the way, this snippet of code is a clue to the endosymbiosis of the distant past where our cells engulfed energetic bacteria to power our much larger cells. The mtDNA forms a circle, instead of a strand, as found in viruses, bacteria and archaea. It also has a high mutation rate, like bacteria, which makes it useful for genetic archaeology.

 

So, for Mother's Day, it seemed appropriate to look at my mom and all of the moms in her maternal line. Our mtDNA pegs us as Maternal Haplogroup H11a, which is common to Nicolaus Copernicus and Marie Antoinette. =)

 

23andMe summarizes: "H originated in the Near East and then expanded after the peak of the Ice Age into Europe, where it is the most prevalent haplogroup today. It is present in about half of the Scandinavian population...

 

H originated about 40,000 years ago in the Near East, where favorable climate conditions allowed it to flourish. About 10,000 years later it spread westward all the way to the Atlantic coast and east into central Asia as far as the Altay Mountains.

 

About 21,000 years ago an intensification of Ice Age conditions blanketed much of Eurasia with mile-thick glaciers and squeezed people into a handful of ice-free refuges in Iberia, Italy, the Balkans and the Caucasus. Several branches of haplogroup H arose during that time, and after the glaciers began receding about 15,000 years ago most of them played a prominent role in the repopulation of the continent.

 

Haplogroup H achieved an even wider distribution later on with the spread of agriculture and the rise of organized military campaigns.

 

Recent research indicates Haplogroup H made its way into the deserts of northern Africa via the Strait of Gibraltar."

 

And for those wondering how we know Copernicus’ mtDNA, we turn to The Spittoon: "Even though DNA begins degrading immediately following death, the genetic material is often preserved in the teeth for hundreds or thousands of years. Scientists studying ancient DNA (aDNA) usually focus on the type of DNA that has the greatest chance of surviving: mitochondrial DNA (mtDNA), which is passed exclusively from mother to children. The sheer abundance of mtDNA makes it much more likely to survive; each cell contains hundreds of copies."

In 2002 Hans Bruno Lund introduced the concept

"Multicomplex Management (MCM)" as a platform

for a new series of management concepts and tools,

e.g. "Expected Creative Potential (ECP)", desig-

ned as personal tools for the CEO of large, multicom-

plex organizations in addition to the traditional mana-

gement concepts and tools.

 

As of January 2010 the new concepts / tools "Multicomplex Management (MCM)" and "Expected Creative Potential (ECP)" were referred to on more than 800.000 websites or 40.000.000 webpages.

    

Literature:

 

Lund, Hans Bruno

Multicomplex Management (MCM)

Version 3

CD-ROM, 741 colored illustrations

Hans Bruno Lund

Skodsborg

Denmark

2009

 

A multicomplex organization:

 

Organization Structure Model used: Nordic Industrial Fund - Nordic Council of Ministers - Bio & Chemistry Division (BCD) - Division REI-activities (Research / Education / Innovation): 5 programmes: NordFood, Nordic Wood, NordPap, NordBio and NordYeast; 748 projects; 6.000 participating private and public companies, institutions, organizations and agencies in 62 countries. BCD connected 180.000 researchers, operators, engineers, technicians and company, organization and agency executives (1998). BCD was - in combination with NordTek (the organization managing the cooperation of the 23 Nordic technical universities) - the largest industrial and technological REI-network in Northern Europe. BCD was a 27.000 ECP Organization connecting 278.000 people totalling 2.7 million ECP.

 

Hans Bruno Lund

Contact: hansbrunolund@hotmail.com

 

Pictures to Multicomplex Management (MCM): 1, 2, 3, ... , 16.

 

Multicomplex Management (MCM) Pictures:

Picture 1 - 9 on Page 1

Picture 10 on Page 2

Picture 11 - 12 on Page 6

Picture 13 - 15 on Page 7

Picture 16 on Page 8

 

Multicomplex Management (MCM) is explained in Picture 2.

 

Expected Creative Potential (ECP) is explained in Picture 2.

 

--------------------------------------------------------------------------------------------

FOUR CATEGORIES OF ORGANIZATION STRUCTURES

--------------------------------------------------------------------------------------------

 

The above mentioned concepts and tools are part of an ongoing project “Multicomplex Management (MCM)”.

 

In “Multicomplex Management” we divide organizations into four categories according to their total ECP:

 

SIMPLE ORGANIZATIONS

Total ECP ranging from 0.1 to approx. 100.

 

SEMICOMPLEX ORGANIZATIONS

Total ECP ranging from approx. 100 to approx. 1.000.

 

COMPLEX ORGANIZATIONS

Total ECP ranging from approx. 1.000 to 10.000.

 

MULTICOMPLEX ORGANIZATIONS

Total ECP exceeding 10.000.

 

=====================================================

BCD BIO INDUSTRIAL COMPLEX - PROJECTS AND ACTIVITIES

=====================================================

 

BCD´s projects / activities was carried out within four INDUSTRIAL COMPLEXES:

 

BIO INDUSTRIAL COMPLEX

FOOD INDUSTRIAL COMPLEX

FOREST INDUSTRIAL COMPLEX and

OTHER INDUSTRIAL AREAS

 

As an example we list the projects / activities carried out within the

 

BIO INDUSTRIAL COMPLEX

 

Z001, Z002, Z003 ... ... ... are the BCD project numbers:

 

Aerobic (ZZ056/059)

Aeromonas (ZZ442)

Affald (ZZ197/369)

Affedtning (ZZ571)

Anaerobic (ZZ100)(ZZ50%)

Anaerobic Processes (ZZ099-102)

Animal Cell Cultures (Z047/421)

Antibodies (Z054/554)

Antimicrobial Activity (Z068)

AOX (Z087)

ARS1 plasmids (ZNY11)

Avgaser från stålugn (Z204)

Avloppsvatten (Z5.3/167)

Bacteria (Z... ...)

BioAutomation

Bioautomation (Z630)

Biodegradation (Z090/092/093)

Biofixation (Z094-098)

Biofunktionella färgsystem (Z403)

Biogasproduktion (Z354)

Biohydrometallurgi

Bioleaching (Z095)

Biological Degradation (Z091/439)

Biological fixation (Z094)

Biological off-gas treatment (Z481)

Biologisk gasrening (Z400)

Biologisk marksanering (Z465)

Biomass (Z249/498)

Bioorganic synthesis (Z061)

Bioorganisk syntese (Z380)

Bioorganiska synteser (Z333)

Bioprocess Engineering (Z037-048)

Bioreactor (Z037/040/041)

Bioreactors (Z045/046)

BioRecNetwork

Bioremediation (Z090)

Biosamarbete Norden Europa (Z459)

Bioseminar (Z468)

Biosensors (Z043)

Biosorbents (Z096)

Biosurfaktanter (Z453)

BIOTANNOR (Z595)

Biotechnica Hannover (Z474)

Biotechnology (Z031-102)

Bioteknik (Z329/349/426)

Bioteknisk metallutvinning (Z502)

Biotekniska metoden (Z2.2.1.4)

Biotekniske substanser (Z377)

Biotekniske substanser (Z454)

Bioteknologi (Z466/490/507)

Bioteknologi (Z355)

Bioteknologikonference (Z424)

Biotester (Z168/170)

Branching enzymes (Z051)

Car.pis. (Z069)

Cell Cultures (Z047)

Cell cycle gene cdc 21 (ZNY29)

Cell response (Z039)

Cellteknologi (Z421)

Cellular Development (Z458)

Cellulasbok Prot.Eng.(Z512)

Cellulase (Z031/060)

Cellulase enzymes (Z032)

Cellulose (Z057/141)

Cisacting mutations (ZNY30)

Civil Guard (Z409)

Cloning (Z051/055/060/NY02/)

Cloning (ZNY03/NY05)

Collagenolytic enzymes (Z066)

Concentration gradients (Z039)

Cryotin (Z065)

Data Man. Waste Water (Z450)

Databases (Z035)

Degradation (Z091/100/439)

Dehydrogenases (Z060)

Design of enzymes (Z356)

Dewatering of Sludges (Z089/438)

Djurkroppar (Z542)

DNA

DNA coding (ZNY03)

DNA gene sequence (ZNY08/NY28)

DNA polymeraser (Z431)

DNAmetoder (Z384)

DNAsymposium (Z401)

Dynabeads (Z471)

Energi (Z608)

Energi biomassa (Z249)

Energisnåla metoder (Z619)

Energy metabolism control (Z048)

Environm. Biotechnology (Z085-102)

Environm. Seafloor mapping (Z496)

Environment (Z120-122)

Enzymatic lipid modification (Z083)

Enzymatic Modification (Z082-084)

Enzymatic mofific. of lipids (Z084)

Enzymatisk affedtning (Z571)

Enzymatisk peptidsyntes (Z251)

Enzyme Catalysis (Z425)

Enzymer (Z147/571)

Enzymer fra marine råstoffer (Z297)

Enzymes (Z051/059/063)

Enzymes (Z090/356/635)

Enzymes in yeast (ZNY24)

Enzymes/Lipidsstipend (Z511)

EPI (Z592)

Eucaryotic tRNA (ZNY26)

EUREIN (Z613)

Evaluation NordBio (Z606)

Expression of genes (ZNY02)

Fab domain (ZNY16)

Fission yeast (ZNY08/NY27/NY29)

Fixation (Z094)

Foaming in bioreactors (Z044)

Fungies (Z... ...)

Förgasning torv (Z254)

Fouling av membran (Z264)

Gas (Z191/254/345/354/400/481)

Gasrensning (Z400)

Gener (ZNY02)

Genetic recombination (ZNY07)

Genteknik Utställning (Z456)

Genteknologi (Z327)

Geotermiska gaser (Z345)

Ginsing (Z258)

Glycoprotein (ZNY01/15/23)

Grampositive cocci (ZNY17)

Grundvandsrensning (Z486)

Gruvvatten (Z298)

Heavy Metals (Z094-098)

Hemaglutinin (ZNY12)

Hemicellulose (Z057)

Hepatocyter (Z169)

Hesteblod (Z336)

Heuristics (Z042)

Household waste (Z100)

Hushållsavfall (Z434)

Hydrolytic Enzymes (Z064-066)

Industrial Enzymes (Z056-058/635)

Industrial waste (Z100)

Inneklimasystem (Z416)

Järnverk (Z190)

Jäst- och växtceller (Z324)

Jästgenetik (Z276)

Jordrensning (Z486)

Klima (Z416)

Kloningsvektorer (Z310)

L. brevis (ZDetmold)(Z080)

L. plantarum (Zvalencia) (Z080)

Lac.Aci.Bac. (Z067-072/312/494)

Lac.Pen. (Z073)

Landfill leachates (Z101/102)

Leachates (Z101/102)

Leaching (Z095)

Light chain (ZNY16)

Lipases (Z031/033/505)

Lipids (Z082-084/511)

Loopfermentor (Z482)

Lysozyme (Z064)

Marin begroing (Z484)

Marine organisms (Z066)

Marine råstoffer (Z297)

Marksanering (Z465/590)

Marksanering (Z524/637)

Mass transfer (Z037)

Maturation processes (ZNY26)

Membrane filtration (Z086)

Membranes (ZNY03/18/19/25)

Methionine (ZNY06/14)

Microtox (Z170)

Mikroalger (Z373)

Mikrobiellt protein (Z193)

Mikrobielt peroxidas (Z259)

Mikrobiologi (Z172)

Mikroemulsioner (Z296)

Mikroformering (Z308)

Mikrosfärer (Z341)

Miljö (Z239/582/585/600/615)

Miljö i garverier (Z194)

Miljöanpassad betong (Z516)

Miljödeklarationer (Z528)

Miljökrav skrotsmält (Z323)

Miljømodellering (Z449)

Miljø-ORS-Paraply (Z527)

Miljøovervågning (Z423)

Miljöprofilering djuptryck (Z515)

Miljørisiko - Gensplejsning (Z371)

Miljøteknologi (Z489)

Mine drainage (Z094)

Mitochondria (ZNY04/18)

Molecular Imprinting (Z440)

Molecular modelling (Z035)

Molekylærbiologi (Z399)

Multidetektor (Z385/411)

Mutant saturation (ZNY08/NY27)

Närsaltreduktion (Z382)

NordBio (Z606)

Nordmiljö (Z196)

NordPhys (Z508)

NordPhys (Z610)

Nuclear dcm (ZNY28)

Nuclear envelope (ZNY20)

Off-gas (Z481)

Öppningssäkerhet (Z343)

PAH (Z092)

Panax (Z258)

PCD (Z092)

Peptidsyntes (Z251)

Phospholipase C (Z036)

Photosynthesis (Z473)

Physiological effects (Z038)

Physiological Engineering (Z508)

Plant Cell Biotechnology (Z049-055)

Pollutants (Z090-093)

Process Environments (Z043)

Profilin (ZNY13)

Prot. Eng. (Z031-036/302/402/NY13)

Proteases (Z058/429)

Protein Eng. Konferens (Z299)

Protein Eng. receptorer (Z367)

Protein secretion (ZNY01/15/23)

Protein software tools (Z031)

Proteinstrukturer (Z477)

Proteolytic mixtures (Z065)

Psychrophilic Org. (Z056-066)

Psykrofile organismer (Z370)

Pyrophosphatase (ZNY18)

Pyrophosphate (ZNY04/18)

RADIOBIO process (Z088)

Remediation (Z090)

Replication control (ZNY11)

RNA polymerases (ZNY10)

RNAs (ZNY10)

Saccharomyces cer. (Z001-030)

Scallop viscera (Z064)

Screening (Z082)

Seafloor (Z496)

Secretion in yeast (ZNY22)

Serine Proteases (Z429)

Skrotsmält (Z323)

Sludge (Z087/089/097/438)

Soil (Z090/092/097)

Solid Waste (Z099-102)

Soluble Starch Synthase (Z050)

Sorbents (Z096)

Stålugn (Z204)

Stålverk (Z190/343/518)

Støveksplosjoner (Z201)

Støy (Z4.1.3.2)

Styrenbemängd luft (Z419)

Termofile enzymer (Z383)

Termofile vektorer (Z430)

Thermophile bakterier (Z300)

Thermophile lipase activity (Z082)

Thermophile organismer (Z370)

Thermophiles (Z056/059)

Thermophiles (Z487)

Thermophilic microbiology (Z099)

Thermophilic Organisms (Z056-066)

Thorothermus Marinus (Z062)

Threonine biosynthesis (ZNY06)

Torv (Z254)

Transcription (ZNY26)

Transcription factors (ZNY10)

Transcription of RNAs (ZNY10)

Transcriptional control (ZNY21)

Transfer RNA (ZNY24)

Transport of proteins (ZNY20)

Troponin C (ZNY13)

Trypsin (Z034)

Tungmetaller (Z173)

Tyrosin hydroksylase (Z313)

Underglycosylated prot.A (ZNY30)

Vatten (Z167/604/608)

Vatten i järn- och stålverk (Z190)

Växtcellbioteknik (Z365/406)

Växtcellbioteknologi (Z406)

Vegetation Mapping (Z443)

Wastes (Z094/096)

Wastewater (Z085/095/098/450)

Water in Fish Industry (Z122)

Water Jet Deboning (Z125)

Xylan (Z062)

Xylanases (Z056/060/062)

Xylose Utilixation (Z447)

Yeast (Z001-030)

Yeast ADE4 gene (ZNY11)

Zinkholdig støv (Z518)

 

Literature

 

Lund, Hans Bruno

Multicomplex Management (MCM)

Version 3

CD-ROM, 741 colored illustrations

Dr. Hans Bruno Lund, Management Consultant

Skodsborg

Denmark

2009

 

Not available in libraries

   

Multicomplex Management (MCM) Expected Creative Potential (ECP) Picture 1 - Organization Structure

 

Organization Structure Model used: Nordic Industrial Fund - Nordic Council of Ministers – Bio & Chemistry Division (BCD) - Division REI-activities (Research / Education / Innovation): 5 programmes: NordFood, Nordic Wood, NordPap, NordBio and NordYeast; 748 projects; 6.000 participating private and public companies, institutions, organizations and agencies in 62 countries. BCD connected 180.000 researchers, operators, engineers, technicians and company, organization and agency executives (1998). BCD was - in combination with NordTek (the organization managing the cooperation of the 23 Nordic technical universities) - the largest industrial and technological REI-network in Northern Europe. BCD was a 27.000 ECP Organization connecting 275.000 people totalling 2.8 million ECP. Photo on Picture 1: Hans Bruno Lund visiting the governor of Oulu province, Finland Dr. Eino Siuruainen during a NordTek seminar.

Multicomplex Management (MCM) is explained in Picture 2, 04.

Expected Creative Potential (ECP) is explained in Picture 2.

Pictures to Multicomplex Management (MCM): 1, 2, 3, 4, 5, 6, 7, 8,

9, 10, 11 and 12.

--------------------------------------------------------------------------------------------

A MULTICOMPLEX ORGANIZATION STRUCTURE - ORGANIZATION

--------------------------------------------------------------------------------------------

NORDIC INDUSTRIAL FUND (NIF)

NORDIC COUNCIL OF MINISTERS (NCM)

BIO & CHEMISTRY DIVISION (BCD)

--------------------------------------------------------------------------------------------

CONTENTS

--------------------------------------------------------------------------------------------

1 BIO & CHEMISTRY DIVISION (BCD)

1.1 NIF HISTORY

1.2 BCD BUSINESS IDEA

1.3 BCD OPERATION AREA

1.4 BCD OPERATION AREA INHABITANTS

1.5 BCD PARTNER-COUNTRIES AND AUTONOMOUS AREAS

1.6 BCD GEOGRAPHIC OPERATION REGIONS

1.7 BCD PARTNERS

1.8 BCD ACTIVITIES

1.9 BCD ORGANIZATION STRUCTURE

1.9.1 - MANAGEMENT

1.9.2 - BIO INDUSTRIAL COMPLEX (BIO)

1.9.3 - FOOD INDUSTRIAL COMPLEX (FOO)

1.9.4 - FOREST INDUSTRIAL COMPLEX (FOR)

1.9.5 - OTHER INDUSTRIAL AREAS (OIA)

1.9.6 BCD – HISTORY AND ACHIEVEMENTS – A RESUME

 

2 MULTICOMPLEX MANAGEMENT (MCM) LITERATURE

--------------------------------------------------------------------------------------------

1.1 NIF HISTORY

--------------------------------------------------------------------------------------------

NIF HISTORY

NIF was established 1973 (the Helsinki Treaty). In 1987 the organization expanded by taking over the activities of NordForsk (a Nordic government agency for basic research). In the new century the activities of NIF (and BCD) were split up between two new-established organizations: A new NordForsk (basic research) and Nordic Innovation Centre (NICe)(applied research and innovation).

BCD (one of NIF's two divisions) was operational from 1991 to 1999.

--------------------------------------------------------------------------------------------

1.2 BCD BUSINESS IDEA

--------------------------------------------------------------------------------------------

BCD BUSINESS IDEA

Initialization, expansion and utilization of Nordic and Nordic / international cooperation networks between relevant partners from the private and the public sectors to the benefit of the Nordic countries´ competitiveness and the wealth and health of their inhabitants and based on internordic / international cooperation projects as the primary tool and improved and new concepts, methods, technologies and products as valuable spinoffs.

--------------------------------------------------------------------------------------------

1.3 BCD OPERATION AREA

--------------------------------------------------------------------------------------------

BCD OPERATION AREA

Approx. 22 million square km

Land: Approx. 6 million square km

Oceans and seas: Approx. 16 million square km

The water quality of the oceans and seas surrounding

the Nordic countries is of extreme importance to the

Nordic economies and the inhabitants health and qua-

lity of life. To protect and improve water quality at land as

well as at sea was therefore a substantial goal in almost

all BCD projects.

--------------------------------------------------------------------------------------------

1.4 BCD OPERATION AREA INHABITANTS

--------------------------------------------------------------------------------------------

BCD OPERATION AREA INHABITANTS

Approx. 45 million

Nordic Countries: Approx. 24 million

Baltic Countries: Approx. 7 million

North West Russia: Approx. 14 million

--------------------------------------------------------------------------------------------

1.5 BCD PARTNER-COUNTRIES AND AUTONOMOUS AREAS

---------------------------------------------------------------------------------------------

BCD PARTNER-COUNTRIES AND AUTONOMOUS AREAS

Aland Islands

Denmark

Estonia

Faroe Islands

Finland

Greenland

Iceland

Latvia

Lithuania

North West Russia

Norway

Sweden

--------------------------------------------------------------------------------------------

1.6 BCD GEOGRAPHIC OPERATION REGIONS

--------------------------------------------------------------------------------------------

A BCD project must have participants - private and public partners - from at least two - better three or four - Nordic countries. Most geographic regions has their specific profile in regard to industry, centers of excellence, inhabitants, culture, nature, environment etc. To identify the optimal combination of partners for a project to be initiated it can sometimes be useful to identify and select partners from related geographic regions in relation to the above mentioned parameters. BCD has 67 geographic operation regions:

 

Denmark: 11

Finland: 9

Iceland: 9

Norway: 10

Sweden: 8

Estonia: 3

Latvia: 3

Lithuania: 3

North West Russia: 11

 

The geographical allocation of BCD´s approx.

10.000 Project Participant Representatives and

other superior officers in the Nordic Countries:

(Project Participant Representatives and

other superior officers in other countries approx.

1.000).

 

DEN-00 Denmark 1.972

DEN-01 København 220

DEN-02 Lyngby 730

DEN-03 Nordsjælland 91

DEN-04 Øvrige Sjælland 123

DEN-05 Fyn 82

DEN-06 Kolding 132

DEN-07 Herning 137

DEN-08 Århus 228

DEN-09 Aalborg 163

DEN-10 Færøerne 47

DEN-11 Grønland 19

FIN-00 Finland 2.089

FIN-01 Helsinki & Espoo 1.274

FIN-02 Turku ( Åbo) 189

FIN-03 Tampere 194

FIN-04 Jyväskylä 57

FIN-05 Lappeenranta 105

FIN-06 Vaasa 108

FIN-07 Kuopio 35

FIN-08 Joensuu 31

FIN-09 Oulu / Kemi 96

ICE-00 Iceland 513

ICE-01 Reykjavik 396

ICE-02 Keflavik 42

ICE-03 Akranes 13

ICE-04 Isafjördur 11

ICE-05 Saudarkrökur 8

ICE-06 Akureyri 15

ICE-07 Egilsstadir 20

ICE-08 Selfoss 5

ICE-09 Vestmannaeyjar 3

NOR-00 2.173

NOR-01 Oslo 646

NOR-02 Ås 301

NOR-03 Moelv 231

NOR-04 Porsgrunn 217

NOR-05 Stavanger 167

NOR-06 Bergen 97

NOR-07 Ålesund 90

NOR-08 Trondheim 329

NOR-09 Bodø 39

NOR-10 Tromsø 56

SWE-00 3.202

SWE-01 Stockholm 868

SWE-02 Lund / Malmö 427

SWE-03 Halmstad 178

SWE-04 Göteborg 402

SWE-05 Borås 329

SWE-06 Norrköping 241

SWE-07 Uppsala 304

SWE-08 Sundsvall 213

SWE-09 Luleå 240

--------------------------------------------------------------------------------------------

1.7 BCD PARTNERS

--------------------------------------------------------------------------------------------

BCD PARTNERS

Private and public companies

Private and public organizations

Universities

Technological institutes

Governments

Government agencies

Other relevant partners

Partners: approx. 6.000 in 62 countries

Private area partners: approx. 4.800

Public area partners: approx. 1.200

See:

Flickr, Hans Bruno Lund´s photostream:

"Multicomplex Management (MCM) Picture 3

--------------------------------------------------------------------------------------------

1.8 BCD ACTIVITIES

--------------------------------------------------------------------------------------------

BCD ACTIVITIES

 

Research

Education

Innovation

Visits

Exchanges

Meetings

Seminars

Workshops

Cources

Reports

Articles

Newsletters

Presentations

Posters

WEB-Activities

Improved Concepts

New Concepts

Improved Methods

New Methods

Improved Technologies

New Technologies

Improved Products

New Products

Patents

Evaluation of Results

Dissemination of Results

Improved Nordic Networks

New Nordic Networks

Improved Nordic/International Networks

New Nordic/International Networks

--------------------------------------------------------------------------------------------

1.9 BCD ORGANIZATION STRUCTURE

--------------------------------------------------------------------------------------------

BCD ORGANIZATION STRUCTURE

Upper right in the picture

REI = Research-Education-Innovation

--------------------------------------------------------------------------------------------

1.9.1 MANAGEMENT

--------------------------------------------------------------------------------------------

MANAGEMENT

 

Management (sand-colored areas/elements)

Head of Division: Hans Bruno Lund (DEN)

Division Director BIO: Marianne Damhaug (NOR) until 1992

Division Director FOOD/OIA: Maija Uusisuo (FIN)

Division Director BIO/FOREST/OIA: Juhani Kuusilehto (FIN)

Deputy Division Director FOREST: Per Brenøe (DEN)

Associate Division Director OIA: Peter Göranson (SWE)

Associate Division Director OIA: Svein Østevik (NOR)

Associate Division Director OIA: Snæbjörn Kristjansson (ICE)

Other Division Administration Staff: 11 officers

Division Advisers: 16

DIVISION REI Areas: 92

DIVISION REI Subareas: 1.200

DIVISION Programmes: 5

DIVISION Part Programmes: 20

DIVISION REI Projects: 748

DIVISION REI Part Projects: approx. 3.000

DIVISION Senior Officers: 370

DIVISION Project Managers: 649

DIVISION Part Project Managers: approx. 2.500

DIVISION Other Officers: approx. 28.000

DIVISION Network Participants (People): approx. 278.000 (incl. NordTek)

DIVISION Network ECP: approx. 2.800.000 (incl. NordTek)

--------------------------------------------------------------------------------------------

1.9.2 BIO INDUSTRIAL COMPLEX (BIO)

--------------------------------------------------------------------------------------------

BIO INDUSTRIAL COMPLEX (BIO)

(blue-colored areas/elements)

Marianne Damhaug (NOR)

Juhani Kuusilehto (FIN)

REI = Research-Education-Innovation

BIO REI Areas: 22

BIO REI Subareas: 340

BIO Programmes: 2 - NORDYEAST & NORDBIO

BIO Part Programmes: 6

BIO REI Projects: 188

BIO REI Part Projects: approx. 750

BIO Senior Officers: 122

BIO Project Managers: 213

BIO Part Project Managers: approx. 640

BIO Other Officers: approx. 7.000

BIO Network Participants (People): approx. 45.000

BIO Network ECP: approx. 535.000

BIO REI Areas:

02 Antibodies and Antigens

04 BioEnergy

05 Biomimetic Materials

06 Bioprocess Engineering

07 BioScience and BioTechnology

20 Environmental BioTechnology

21 Environmental Technology

24 Food BioTechnology

30 Genes and GeneTechnology

35 Industrial Enzymes

37 Marine Biology and BioTechnology

40 BioHydroMetallurgi

45 NeuroBiology and InformationsTransfer

47 Biological OffGas Treatment

50 Physiological Engineering

Project example with Part Projects:

Z508 Physiological Engineering:

Part Projects:

Z508.1 Energy and redox balances during aerobic growth

Z508.2 Regulation of energy flux at anaerobic conditions

Z508.3 Xylose metabolizing Saccharomyces cerevisiae

Z508.4 Physiological responses of Sac.Cer. to SubConVar

Z508.5 Morphological charact. of Penicillium chrysogenum

Z508.6 Morphology and amylase production in Aspergillus oryzae

 

The Research Team:

Albers, Eva

Alexander, N J

Anderlund, Mikael

Bao, Xing

Carlsen, Morten

Christensen, Lars H

Deleuran, Jan

Edelmann, Kari

Ehlde, Magnus

Einarsson, Sigbjørn

Eliasson, Anna

Ellingsen, Trond

Enari, Tor-Magnus

Enfors, Sven-Olof

Flenø, Bent

Franzén, Carl J

George, Stefan

Gram, Jens

Granstrøm, Tom

Gustafsson, Lena

Hahn-Hägerdal, Bärbel

Haldrup, Anna

Hallborn, J

Hansen, Tronn

Hjortkjær, Poul

Holmgreb, K

Jeppsson, Helena

Johansen, Kenneth

Johansson, Björn

Jørgensen, Birthe R

Karsbøl, Birgitte

Klein, Christopher

Korhola, Matti

Krabben, Preben

Kristjansson, Jakob

Larsen, Susanne Slot

Larsson, Christer

Larsson, Gen

Lidén, Gunnar

Londonsborough, John

Meinander, Nina

Michelsen, M L

Mikkelsen, Jørn D

Mølgaard, Henrik

Mørkeberg, R

Nielsen, Jens (Project Manager)

Niklasson, Claes

Nilsson, Annika

Nybergh, Paula

Ojamo, Heikki

Olkku, Juhani

Olsson, Lisbeth

Overballe-Petersen, C

Pakula, Tiina

Palmqvist, Eva

Parkkinen, Elke

Peltola, Petri

Penttilä, Merja

Pettersson, Lennart

Pham, Hop

Prior, B A

Pronk, Jack

Påhlman, Inga-Lil

Rasmussen, Preben

Reuss, Mathias

Ruohonen, Laura

Rønnow, Birgitte

Salminen, Antti

Salonen, Laura

Santerre, Anne

Schmidt, Karsetn

Schulze, Ulrik

Skoog, K

Skov, Allan

Smits, Hans Peter

Spohr, Anders

Suhr-Jessen, Trine

Søderblom, Tore

Taherzadeh, Mohammad

Thevelein, J

Thomas, Colin

Toma, Simona

Tufvesson, Göran

Valadi, Hadi

van Dam, Karel

van Dijken, J P

Villadsen, John

Visser, Jaap

Walfridsson, Mats

Winell, Anna

Winge, Michael

Zacchi, Guido

Zimmerman, Friedrich

Aarts, Robert

  

Participants:

  

Alko Oy

Amsterdam University

Birmingham University

Bryggerilaboratorium Oy AB

Chalmers Technical University

Cheminova A/S

Danisco Biotechnology A/S

Delft University of Technology

Dumex A/S

Göteborg University

IceTec

Kungliga Tekniska Högskolan

Lahden Poltimo Oy

Novo Nordisk A/S

Pripps AB

Primalco Oy

SINTEF

Skåne Brännerier AB

Technical University of Denmark

Technische Universität Darmstadt

Universität Stuttgart

VTT

Waageningen University

  

51 PlantCell Biology and BioTechnology

57 Protein Engineering

 

Project examples (without listing Part Projects):

Z037 Fluid dynamics and mass transfer in bioreactors (BR)

Z038 Physiological effects of oscillating fermentation parameters

Z039 Kinetics of cell responce to local conc. gradients in BR

Z040 Multi-dimensional modelling of flow-processes in BR

Z041 On-line HPLC control of mammalian cell bioreactors

Z042 Bioprocess monotoring system based on ESC / HEU

Z043 Implementation of biosensors in process environments

Z044 Mechanisms of foaming in bioreactors

Z045 Productivity of bioreactors (I)

Z046 Productivity of bioreactors (II)

63 Recycling

73 Thermophilic and Psychrophilic Organisms

74 Waste and WasteWater Treatment

75 Yeast and YeastTechnology

84 LifeCycle Assessment (LCA)

NORDYEAST

Project examples (without listing Part Projects):

Z001 Protein secretion and glycoprotein production in Sac.Cer.

Z002 Molecular cloning and expression of genes by key enzymes

Z003 Cloning and studies of DNA coding for g-3-p-d of Sac.Cer.

Z004 Membrane bound IPP in mitochondria from Sac.Cer.

Z005 Cloning of DNA alkylation genes from yeast

Z006 Regulation of methionine-threonine biosynthesis

Z007 Studies on genetic recombination in Sac.Cer.

Z008 MS of the DNA gene sequence in Saccharomyces Cerevisiae

Z009 Exp. and sec. in yeast of human parathyroid hormone

Z010 RNA polymerases and TF in transcription of RNAs

NORDBIO

NORDBIO Part Programmes:

NB-01 Protein Engineering

NB-02 Bioprocess Engineering

NB-03 Plant Cell Biotechnology

NB-04 Thermophiles and Psychrophiles

NB-05 Food Biotechnology

NB-06 Environmental Biotechnology

------------------------------------------------------------

1.9.3 FOOD INDUSTRIAL COMPLEX (FOO)

------------------------------------------------------------

FOOD INDUSTRIAL COMPLEX (FOO)

(orange-colored areas/elements)

Maija Uusisuo (FIN)

REI = Research-Education-Innovation

FOO REI Areas: 10

FOO REI Subareas: 180

FOO Programmes: 1 - NORDFOOD

FOO Part Programmes: 4

FOO REI Projects: 125

FOO REI Part Projects: approx. 500

FOO Senior Officers: 37

FOO Project Managers: 107

FOO Part Project Managers: approx. 425

FOO Other Officers: approx. 5.000

FOO Network Participants (People): approx. 30.000

FOO Network ECP: approx. 360.000

FOO REI Areas:

03 Aquaculture

11 Cereals

22 Fishery and Fish

Project examples (without listing Part Projects):

Z217 Nordisk Blåvilling

Z290 Frysfartyg

Z339 Atlantic Salmon

Z346 Hippoglossus

Z437 Landbaserte Anlegg

Z461 Monotoring and PC in Aquaculture

Z483 Hälleflundra, Torsk och Havskat

Z563 CIMFISK - IT in Fish Fillet Factories

Z570 BENEFISH - New Technologies in the Nordic Fishindustries

Z594 Havmiljøets påvirkning af fisks reproduktionsevne

23 Fish Diseases

25 Food Hygiene

26 Food Packaging and Transportation

27 Food Processing

Project examples (without listing Part Projects):

Z120 Cleaner production

Z121 Environmental beer production

Z122 Water in fish industry

Z123 Nordic shellfish

Z124 Value from heads

Z125 Water jet deboning

Z126 Aseptic safety

Z127 Probiotic foods

Z128 Rye technology and its influence on health

Z129 Structures in food fat

28 Food Quality

29 Food Technology

Project examples (without listing Part Projects):

Z103 Fish - Packaging and Transportation

Z104 Aroma Transfer in PET

Z105 Shelf Life Prediction

Z107 Salmon Quality

Z108 Microbial Antagonists

Z109 Managing the Meat Tend Process

Z110 Sensoric Calibration

Z111 Fluorescence Screening

Z112 Quality of Emulsions

Z113 Lean Logistics

Let us as an example take a closer look at

Project Z115 On Line Measuring Control

Project Participants

  

Denmark

 

Bioteknologisk Institut

Paaske Jensen

 

Danisco Sugar Development

Ole Hansen

Danmarks Fiskeriundersøgelser

Erling Larsen

 

Fødevaregruppen

Finn Holm

 

KVL

Lars Munk

 

Lactosan A/S

Jørgen Schmidt

 

Meincke A/S

Peter Clausen

 

Slagteriernes Forskningsinstitut

J Rud Andersen

 

Foss Electric A/S

Torben Lapp

 

Reciprotor Engineering A/S

Per Andersen

 

Q-Interline

Anders Larsen

 

Steins Laboratorium A/S

Jakob Korsgaard

 

Finland

 

Ingman Foods Oy AB

Hans Ingman

 

Process Flow Ltd Oy

Björn Jernström

Saarioinen Oy

Mirja Rautakoski

 

Oy Snellman AB

Rolf Snellman

 

Sucros Oy

Juha Oravainen

 

Hutiia Research Centre

Jonas Slotte

 

VTT Bio- & Livsmedelsteknik

Arvo Kinnunen

 

Software Point Oy

Andrea Holmberg

 

Iceland

 

Fiskeriindustriens Forskningsinstitut

Helga Eyjófsdóttir

 

Marel HF

Sigurpáll Jonsson

 

Milk Distribution Centre

Einar Matthiasson

 

IceTec

Hannes Hafsteinsson

 

Univesity of Iceland

Kristberg Kristbergsson

 

Landbruges Forskningsinstitut

Gudjón Torkelsson

 

Industriforbundet

Ragneidur Hédinsdóttir

 

Norwegen

 

Mills DA

Narinder Singh

Maarud A/S

Terje Drøyvold

 

A/S Margarinfabrik Norge

Aziz Fooladi

 

Matforsk

Jens Petter Wold

 

Nerliens Kemisk-Tekniske A/S

Vigdis Rustad

 

Norges Lantbrukshøgskole

Ingolf F Nes

 

Norsk Kjøtt

Ole-Johan Røtterud

Tine Norske Meierier BA

Svein Kloster

 

T Skretting A/S

Astrid Staumbotn

 

Stabburet A/S

Anita Bakker

 

SINTEF Kjemi Havbruk

Marit Aursand

 

Sweden

 

Abba Seafood AB

Göran Sjögren

 

Procordia Food AB

Ene Pilman-Willers

 

Lunds Universitet Kemicentrum

Ingegerd Sjöholm

 

Kraft Freia Marabou AB

Thomas Wassholm

 

Oleinitec AB

Marlene Jegeborn

Arla F&U

Clas Johan Dahlsten

 

Pentronic AB

Roland Gullqvist

 

Pripps AB

Klas Johansson

 

Pååls Bröd AB

Bo Folkesson

Radians Innova AB

Bengt Kleman

SIK

Christana Skjöldebrand (Project Manager)

 

Sveriges Lantbruksuniversitet

Ingemar Hansson

 

STFi

Anders Pettersson

 

Charkdelikatesser AB

Anna-Karin Norén

Svenska Nestlé AB

Anita Johansson

Foss Sverige AB

Ingrid Mild / Niklas Persson

 

Tekniska Högskolan Linköping

Alexander Lauber

 

Tetra Pack Food AB

Christer Lanzingh

 

Wasabröd AB

Bengt Carlson

 

Köttforskningsinstituttet

Magnus Wahlgren

 

Nestlé R&D AB

Jennifer Cloke

Bergman & Beving Process AB

Per Henriksson

 

Teltec Electronic AB

Philip Dahl

 

Candelia AB

Urban Eriksson

 

Sensor Control AB

Björn Zetterberg

 

Danfoss AB

Anders Leidermark

 

Nordic Sensor Technologies AB

Andreas Bunge

 

Electrona-Sievert AB

Alf Mikkelä

 

Mettler-Toledo AB

Peter Tinér

 

Korsnäs AB

Jan Jynnskog

 

Sigma Teknik AB

Stellan Lundberg

 

Foss Tecator AB

Karin Thente

  

The participating industrial companies

had on a global basis:

 

Revenue: 100 billion €

Employees: 500.000

 

53 Polysaccharides

 

NORDFOOD

NORDFOOD Part Programmes:

NF-01 Food Packaging and Transportation

NF-02 Food Quality

NF-03 Food Hygien

NF-04 Food Processing

 

One out of several significant milestones achieved as a result of NORDFOOD was the set up of the European REI cooperation SAFEFOODERA – Safer food for 446 million people. Headed by two of BCDs former executive officers Mr. Ola Eide from Norway and Mr. Oddur Már Gunnarsson from Iceland the National Food Authorities of 18 European countries now works together to improve food quality and food hygiene. The 18 countries are: Basque Country, Belgium, Cyprus, Denmark, Finland, France, Germany, Hungary, Iceland, Italy, Netherlands, Norway, Poland, Portugal, Slovenia, Sweden, Turkey and United Kingdom.

 

Over the years hundreds of Nordic Industrial Fund REI projects or initiatives has resulted in expanded efforts with new European partners under the auspices of the EU research programmes or EUREKA.

--------------------------------------------------------------------------------------------

1.9.4 FOREST INDUSTRIAL COMPLEX (FOR)

--------------------------------------------------------------------------------------------

FOREST INDUSTRIAL COMPLEX (FOR)

(green-colored areas/elements)

Juhani Kuusilehto (FIN)

Per Brenøe (DEN)

REI = Research-Education-Innovation

FOR REI Areas: 13

FOR REI Subareas: 220

FOR Programmes: 2 - NORDPAP & NORDIC WOOD

FOR Part Programmes: 10

FOR REI Projects: 170

FOR REI Part Projects: approx. 680

FOR Senior Officers: 78

FOR Project Managers: 103

FOR Part Project Managers: approx. 570

FOR Other Officers: approx. 6.000

FOR Network Participants (People): approx. 40.000

FOO Network ECP: approx. 475.000

FOR REI Areas:

49 Paper as Carrier of Informations

54 Printing Technology

58 Pulp and Paper Bleaching

59 Pulp and Paper Fibers

Project examples (without listing Part Projects):

Z133 Pot. titrering och polyelektrolyttitrering

Z134 Ytsammensättning, ytenergi och syra-base-egenskaper

Z135 Anvendelse av dielektrisk spektroskopi

Z136 Karakterisering av fiber med biotekniska metoden

Z137 Elektromikroskopi

Z138 Konfokal mikroskopi og billedanalyse

Z139 Porstorlek v.h.a. omvendt storlek kromatografi

Z140 Porstorlek v.h.a. NMR-metodik

Z141 Cellulosens reaktivitet og krystallinitet

Z142 TB-method för mättning av specific yta

60 Pulp and Paper EU-Standardization

61 Pulp and Paper Technology

76 Environmental Properties of Wood

77 Properties and Applications of Nordic Wood

78 Nordic Wood as a Construction Material

79 Marketing of Nordic Wood

80 Nordic Wood and the Asian Markets

81 Wood Production

83 Wood Technology

 

Project examples (without listing Part Projects):

Z177 Trä och miljö

Z527 Skog-Trä-Miljö

Z528 Miljödeklaration

Z529 Trä-F&U-Miljöinformation

Z530 Spånplader i møbelindustrien

Z531 Furu Kjernved

Z178 Datorprogram Limträ

Z179 Brandsäkra trähus

Z532 Våtlimede byggkomponenter

Z181 Styrkesortering ger mervärde

NORDPAP

NORDPAP Part Programmes:

NP-01 Pulp and Paper Fibers

NP-02 Pulp and Paper Bleaching

NP-03 Paper as Carrier of Informations

NP-04 Pulp and Paper EU-Standardization

NORDIC WOOD

NORDIC WOOD Part Programmes:

NW-01 Environmental Properties of Wood

NW-02 Properties and Applications of Nordic Wood

NW-03 Nordic Wood as a Construction Material

NW-04 Marketing of Nordic Wood

NW-05 Nordic Wood and the Asian Markets

NW-06 Wood Production

We often think that cross-border REI activities, regional or global, are the playground for large enterprises as it is often the case. BCD had more than 70% of the largest Nordic enterprises as active project participants.

Very encouraging was the fact that many SMB´s found their way to Nordic REI cooperation.

In NORDIC WOOD as an example 21 carpenter guilds from the following small or mediumzised Danish towns participated in the research: ESBJERG, FREDERICIA, FREDERIKSHAVN, HADERSLEV, HERNING, HILLERØD, HJØRRING, HOLSTEBRO, KOLDING, MARSTAL, NYKØBING FALSTER, ODENSE, RANDERS, ROSKILDE, SILKEBORG, SKIVE, SVENDBORG, SØNDERBORG, ÅBENRÅ, AALBORG / NØRRESUNDBY and ÅRHUS cooperated with large companies such as ABB, AKZO NOBEL, ASSI-DOMÄN, COWI, ENZO-GUTZEIT and IKEA.

--------------------------------------------------------------------------------------------

1.9.5 OTHER INDUSTRIAL AREAS (OIA)

--------------------------------------------------------------------------------------------

OTHER INDUSTRIAL AREAS (OIA)

(red- and brown-colored areas/elements)

Juhani Kuusilehto (FIN)

Peter Göranson (SWE)

Svein Østevik (NOR)

Maija Uusisuo (FIN)

Snæbjörn Kristjansson (ICE)

REI = Research-Education-Innovation

OIA REI Areas: 48

OIA REI Subareas: 460

OIA Programmes: 0

OIA Part Programmes: 0

OIA REI Projects: 265

OIA REI Part Projects: approx. 1.060

OIA Senior Officers: 106

OIA Project Managers: 226

OIA Part Project Managers: approx. 900

OIA Other Officers: approx. 10.000

OIA Network Participants (People): approx. 64.000

OIA Network ECP: approx. 760.000

OIA REI Areas:

01 Allergy Research

09 Cancer Research

10 Catalysis and Catalysts

12 Chemical Fibers and Polymers

13 Chemistry and Chemical Technology

Project examples (without listing Part Projects):

Z194 Miljö i garverier

Z198 Olieseparation

Z200 Chromgarvningsmetode

Z207 Korrosionsskyddfärg

Z595 Biotannor

Z497 Adsorption av polymerer

Z578 Lut- och syraprocess

Z492 Processregulering

Z491 Styrd denitrifikation

Z475 Crude oil emulsions

14 Colours and Paints

15 Concrete Technology

16 Corrosion

32 Hormones

33 Immunology and ImmunoTechnology

34 Implantations and ImplantationTechnology

39 Medicine-Pharma-Health

41 Mineralogy and Minerals

48 Offshore Technology

52 Plasma and PlasmaTechnology

69 Supercritical Technologies

70 Surfaces and SurfaceTechnology

71 Tanning and TanningTechnology

08 Business Development

17 Culture and Technology

22 Expert Systems

31 Global REI-Relations

36 Information Technology

38 Measuring Technology

42 Molecule Structures and Modelling

43 NanoTechnology

55 ProcessTechnology

56 Product Development

62 Product Quality & Quality Management

64 Research Management

66 Sensors and SensorTechnology

67 Simulation and Modelling

68 SMBs

72 Technolgy Management

82 Systems Research and Development

44 REI Networks

18 Doctoral Education

19 Engineering Education

46 Technical Universities

Project examples (without listing Part Projects):

NTU = Nordic Technical Universities

Z476 NTU Students Seminar (NTUSS)

Z540 Nordic Industrial Researcher Education Programme (NIREP)

Z551 NTU Students Exchange Programme (NTUSEP)

Z555 NTU PhD Students Exchange Programme (NTUPSEP)

Z584 NTU Presidents Meeting & Industrial Seminar Norway 1993

Z513 NTU Presidents Meeting & Industrial Seminar Iceland 1994

Z517 NTU Presidents Meeting & Industrial Seminar Denmark 1995

Z520 NTU Presidents Meeting & Industrial Seminar Finland 1996

Z633 NTU Presidents Meeting & Industrial Seminar Sweden 1997

Z722 NTU Presidents Meeting & Industrial Seminar Norway 1998

65 Technology Forecasting

85 Regional Development

86 Materials Technology - Aluminium

87 Materials Technology - Ceramics

88 Materials Technology - Composites

89 Materials Technology - Simulation

90 Materials Technology - Surfaces

91 Materials Technology - Steel

92 General Materials Technology

Project examples (without listing Part Projects):

Z275 Oxidceramics

Z282 Zeolites

Z398 Eurodyn - High Technology Gas Turbine

Z591 Material - POM - Polyacetal

Z648 Composites and Sandwich Structures in Ship Construction

Z678 SOL Materials

Z683 Ferroalloys in the Nordic Countries

Z684 Tribology (Friction - Lubrication - Wear)

Z688 Fenite Element Analysis (FEA) in the Automotive Industries

Z713 Nordic Aluminium Cluster (NAC)

--------------------------------------------------------------------------------------------

1.9.6 BCD – HISTORY AND ACHIEVEMENTS – A RESUME

--------------------------------------------------------------------------------------------

More than 25 million people in the Nordic countries – and many more around the World – are each day and many times using or consuming products which were created or improved in one of the Nordic Industrial Fund´s Bio & Chemistry Division´s more than 50.000 research-, education- and innovation activities. More than 500.000 engineers, technicians, workers, university teachers, students, researchers, managers and officials from the 5 Nordic countries have – from a start in 1973 – gained new knowledge in their combined efforts to improve Nordic competitiveness, the Nordic environment and the health and quality of life of the countries populations and in many cases in crossborder cooperation with industrial and institutional partners from 57 other countries. --------------------------------------------------------------------------------------------

2 MULTICOMPLEX MANAGEMENT (MCM) - LITERATURE

--------------------------------------------------------------------------------------------

Lund, Hans Bruno

Multicomplex Management (MCM)

CD-ROM, 678 colored illustrations

Dr. Hans Bruno Lund, Management Consultant

Skodsborg

Denmark

2009

   

"In many respects stromatolites are the most intriguing fossils that are our singular visual portal (except for phylogenetic determination of conserved nucleic acid sequences and molecular fossils) into deep time on earth, the emergence of life, and the eventual evolving of the beautiful life forms from Cambrian to modern time.

 

A small piece of stromatolite encodes biological activity perhaps spanning thousands of years. In broad terms, stromatolites are fossil evidence of the prokaryotic life that remains today, as it has always been, the preponderance of biomass in the biosphere. For those that subscribe to the theory of the living earth, it is the prokaryotes that maintain the homeostasis of the earth, rendering the biosphere habitable for all other life. They maintain and recycle the atomic ingredients upon which proteins that "are" all life are made, including oxygen, nitrogen and carbon.

 

We humans are, in simple terms, bags of water filled with proteins and prokaryotic bacteria (the bacteria in your body outnumber the cells in your body about 10 to 1). We humans have descended from organisms that adapted to living in a prokaryotic world, and we humans retain (conserved in evolutionary terms) in our mitochondria the cellular During the Precambrian, microbial mats built stromatolites along all of earth's shorlines machinery to power our cells that we inherited (i.e., endosymbiosis) from the prokaryotes of deep time on earth.

www.fossilmall.com/Science/About_Stromatolite.htm

Mãng cầu Xiêm, còn gọi là mãng cầu gai, na Xiêm, na gai Mãng cầu xiêm có tên khoa học là Annona muricata thuộc họ thực vật Annonaceae. (Annona, phát xuất từ tên tại Haiti, anon, nghĩa là thu-hoạch của năm ‘muricata’ có nghĩa l à mặt bên ngoài sần lên, có những mũi nhọn).

 

Các tên thông thường: Soursop (Anh-Mỹ), Guanabana, Graviola, Brazilian Paw Paw, Corossolier (Pháp), Guanavana, Durian benggala Nangka londa.

thuộc loại tiểu mộc, có thể cao 6-8 m. Vỏ thân có nhiều lỗ nhỏ màu nâu. lá màu đậm có mùi thơm, không lông, xanh quanh năm. Hoa màu xanh, mọc ở thân. Quả mãng cầu xiêm to và có gai mềm. Thịt quả ngọt và hơi chua, hạt có màu nâu sậm. Cây mãng cầu xiêm sống ở những khu vực có độ ẩm cao và có mùa Đông không lạnh lắm, nhiệt độ dưới 5°C sẽ làm lá và các nhánh nhỏ hỏng và nhiệt độ dưới 3°C thì cây có thể chết. Cây mãng cầu xiêm được trồng làm cây ăn quả. Quả mãng cầu Xiêm nặng trung bình từ 1-2 kg có khi đến 2,5 kg, vỏ ngoài nhẵn chỉ phân biệt múi nọ với múi kia nhờ mỗi múi có một cái gai cong, mềm vì vậy còn có tên là mãng cầu gai.

 

Giới (regnum): Plantae

(không phân hạng): Angiospermae

(không phân hạng) Magnoliidae

Bộ (ordo): Magnoliales

Họ (familia): Annonaceae

Chi (genus): Annona

Loài (species): A. muricata

 

Mãng cầu xiêm là một trái cây nhiệt đới rất thường gặp trong vùng Nam Mỹ và Đông Ấn (West Indies). Đây cũng là một trong những cây đầu tiên được đưa từ Mỹ châu về lục địa ‘Cựu Thế Giới’, và mãng cầu xiêm sau đó được trồng rộng rãi suốt từ khu vực Đông Nam Trung Hoa sang đến Úc và những vùng bình nguyên tại Đông và Tây Phi châu.

 

Đặc tính thực vật:

Mãng cầu xiêm thuộc loại tiểu mộc, có thể cao 6-8 m. Vỏ thân có nhiều lỗ nhỏ màu nâu. Lá hình trái xoan, thuôn thành ngọn giáo, mọc so le. Lá có mùi thơm. Phiến lá có 7-9 cặp gân phụ. Hoa mọc đơn độc ở thân hay nhánh già; hoa có 3 lá đài nhỏ màu xanh, 3 cánh ngoài màu xanh-vàng, và 3 cánh trong màu vàng. Nhị và nhụy hoa tạo thành 1 khối tròn, Trái thuộc loại trái mọng kép, lớn, hình trứng phình dài 20-25 cm, màu xanh lục hay vàng xanh, khi chín quá mức sẽ đổi sang vàng. Trái có thể kết tại nhiều vị trí khác nhau trên thân, cành hay nhánh con, và có thể cân nặng đến 5kg (15 lb). Vỏ rất mỏng, bên ngoài có những nốt phù thành những múi nhỏ nhọn hay cong, chứa nhiều hạt màu đen. Trái thường được thu hái lúc còn xanh, cứng và ăn ngon nhất vào lúc 4-5 ngày sau khi hái, lúc đó quả trở thành mềm vừa đủ để khi nhấn nhẹ ngón tay vào sẽ có một vết lõm. Phần thịt của tr ái màu trắng chia thành nhiều khối chứa hạt nhỏ.

 

Thành phần dinh dưỡng và hóa học:

 

100 gram phần thịt của trái mãng cầu xiêm, bỏ hạt, chứa:

- Calories 53.1-61.3

- Chất đạm 1 g

- Chất béo 0.97 g

- Chất sơ 0.79 g

- Calcium 10.3 mg

- Sắt 0.64 mg

- Magnesium 21 mg

- Phosphorus 27.7 mg

- Potassium 287 mg

- Sodium 14 mg

- Beta-Carotene (A) 2 IU

- Thiamine 0.110 mg

- Riboflavine 0.050 mg

- Niacin 1.280 mg

- Pantothenic acid 0.253 mg

- Pyridoxine 0.059 mg

- Vitamin C 29.6 mg

 

Lá mãng cầu xiêm chứa các acetogenins loại monotetrahydrofurane như annopentocins A, B và C; Cis và Trans-annomuricin-D-ones(4, 5), Muricoreacin, Muricohexocin… ngoài ra còn có tannin, chất nhựa resin.

 

Trái mãng cầu xiêm chứa các alkaloids loại isoquinoleine như: annonaine, nornuciferine và asimilobine.

 

Hạt chứa khoảng 0.05 % alcaloids trong đó 2 chất chính là muricin và muricinin. Nghiên cứu tại ĐH Bắc Kinh (2001) ghi nhận hạt có chứa các acetogenins: Muricatenol, Gigantetrocin-A, -B, Annomontacin, Gigante tronenin. Trong hạt còn có các hỗn hợp N-fatty acyl tryptamines, một lectin có ái lực mạnh với glucose/mannose; các galactomannans..

 

Vài phương thức sử dụng:

 

Mãng cầu xiêm được dùng làm thực phẩm tại nhiều nơi trên thế giới. Tên soursop, cho thấy quả có thể có vị chua, tuy nhiên độ chua thay đổi, tùy giống, có giống khá ngọt để ăn sống được, có giống phải ăn chung với đường. Trái chứa nhiều nước, nên thường dùng để uống hơn là ăn! Như tại Brazil có món Champola, tại Puerto Rico có món Carato là những thức uống theo kiểu ‘nuớc sinh tố’ ở Việt Nam: mãng cầu xay chung với sữa, nước (tại Philippines, còn pha thêm màu xanh, đỏ như sinh tố pha si-rô ở Việt Nam)

 

Mãng cầu xiêm (lá, rễ và hạt) được dùng làm thuốc tại rất nhiều nơi trên thế-giới, nhất là tại những quốc gia Nam Mỹ:

 

Tại Peru, trong vùng núi Andes, lá mãng cầu được dùng làm thuốc trị cảm, xổ mũi; hạt nghiền nát làm thuốc trừ sâu bọ; trong vùng Amazon, vỏ cây và lá dùng trị tiểu đường, làm dịu đau, chống co giật.

 

Tại Guyana: lá và vỏ cây, nấu thành trà dược giúp trị đau và bổ tim.

 

Tại Brazil, trong vùng Amazon: lá nấu thành trà trị bệnh gan; dầu ép từ lá và trái còn non, trộn với dầu olive làm thuốc thoa bên ngoài trị thấp khớp, đau sưng gân cốt.

 

Tại Jamaica, Haiti và West Indies: trái hay nước ép từ trái dùng trị nóng sốt, giúp sinh sữa và trị tiêu chảy; vỏ thân cây và lá dùng trị đau nhức, chống co-giật, ho, suyển.

 

Tại Ấn Độ, cây được gọi theo tiếng Tamilnadu là mullu-chitta: quả dùng chống thiếu vitamin C ( scorbut); hạt gây nôn mửa và làm se da.

 

Tại Việt Nam, hạt được dùng như hạt na, nghiền nát trong nước, lấy nước gột đầu để trị chí rận. Một phương thuốc Nam khá phổ biến để trị huyết áp cao là dùng vỏ trái hay lá mãng cầu xiêm, sắc chung với rễ nhàu và rau cần thành nước uống (bỏ bã) mỗi ngày.

Dược tính của mãng cầu xiêm:

 

Các nhà khoa học đã nghiên cứu về dược tính của mãng cầu xiêm từ 1940 và ly trích được nhiều hoạt chất. Một số các nghiên cứu sơ khởi được công bố trong khoảng thời gian 1940 đến 1962 ghi nhận vỏ thân và lá mãng cầu xiêm có những tác dụng làm hạ huyết áp, chống co giật, làm giãn nở mạch máu, thư giãn cơ trơn khi thử trên thú vật. Đến 1991, tác dụng hạ huyết áp của lá mãng cầu xiêm đã được tái xác nhận. Các nghiên cứu sau đó đã chứng minh được là dịch chiết từ lá, vỏ thân, rễ, chồi và hạt mãng cầu xiêm có những tác dụng kháng sinh chống lại một số vi khuẩn gây bệnh, và vỏ cây có khả năng chống nấm.

 

Hoạt tính của các acetogenins:

 

Trong một chương trình nghiên cứu về dược thảo của National Cancer Institute vào năm 1976, lá và chồi của mãng cầu xiêm được ghi nhận là có hoạt tính diệt các tế bào của một số loại ung thư. Hoạt tính này được cho là do ở nhóm hợp chất, đặt tên là annonaceous acetogenins

 

Các nghiên cứu về acetogenins cho thấy những chất này có khả năng ức chế rất mạnh phức hợp I (Complex I) ở trong các hệ thống chuyển vận điện tử nơi ty lạp thể (mitochondria) kể cả của tế bào ung thư [ các cây của gia đình Anonna có chứa nhiều loại acetogenins hoạt tính rất mạnh, một số có tác dụng diệt tế bào u-bướu ở nồng độ EC50 rất thấp, ngay ở 10-9 microgram/ mL.]

 

Trường Đại Học Purdue là nơi có nhiều nghiên cứu nhất về hoạt tính của gia đình Annona, giữ hàng chục bản quyền về acetogenins, và công bố khá nhiều thí nghiệm lâm sàng về tác dụng của acetogenins trên ung thư, diệt bướu ung độc:

 

Một nghiên cứu năm 1998 ghi nhận một loại acetogenin trích từ mãng cầu xiêm có tác dụng chọn lựa, diệt được tế bào ung thư ruột già loại adenocarcinoma, tác dụng này mạnh gấp 10 ngàn lần thuốc Adriamycin.

Theo các kết quả nghiên cứu tại Purdue thì: ‘các acetogenins từ annonaceae, là những acid béo có dây carbon dài từ 32-34, phối hợp với một đơn vị 2-propanol tại C-2 để tạo thành một vòng lactone. Acetogenins có những hoạt tính sinh học như chống u-bướu, kích ứng miễn nhiễm, diệt sâu bọ, chống protozoa, diệt giun sán và kháng sinh. Acetogenins là những chất ức chế rất mạnh NADH:Ubiquinone oxidoreductase, vốn là một enzym căn bản cần thiết cho complex I đưa đến phàn ứng phosphoryl-oxid hóa trong mitochondria. Acetogenins tác dụng trực tiếp vào các vị trí ubiquinone-catalytic nằm trong complex I và ngay vào men glucose dehydrogenase của vi trùng. Acetogenins cũng ức chế men ubiquinone-kết với NADH oxidase, chỉ có nơi màng plasma của tế bào ung thư.(Recent Advances in Annonaceous Acetogenins-Purdue University -1997)

 

Các acetogenins Muricoreacin và Muricohexocin có những hoạt tính diệt bào khá mạnh trên 6 loại tế bào ung thư như ung thư tiền liệt tuyền (prostate) loại adenocarcinoma (PC-3), ung thư lá lách loại carcinoma (PACA-2) (ĐH Purdue, West LaFayette, IN- trong Phytochemistry Số 49-1998)

 

Một acetogenin khác: Bullatacin có khả năng diệt được các tế bào ung thư đã kháng được nhiều thuốc dùng trong hóa-chất trị liệu, do ở hoạt tính ngăn chận sự chế tạo Adenosine triphosphate (ATP) cần thiết cho hoạt động của tế bào ung thư (Cancer Letter June 1997)

 

Các acetogenins trích từ lá Annomutacin, cùng các hợp chất loại annonacin-A-one có hoạt tính diệt được tế bào ung thư phổi dòng A-549 (Journal of Natural Products Số Tháng 9-1995)

 

Các duợc tính khác:

 

Các alkaloid: annonaine, nornuciferine và asimilobine trích được từ trái có tác dụng an thần và trị đau: Hoạt tính này do ở khả năng ức chế sự nối kết của [3H] rauwolscine vào các thụ thể 5-HT1A nằm trong phần yên của não bộ. (Journal of Pharmacy and Pharmacology Số 49-1997).

 

Dịch chiết từ trái bằng ethanol có tác dụng ức chế được siêu vi khuẩn Herpes Simplex (HSV-1) ở nồng độ 1mg/ml (Journal of Ethnophar macology Số 61-1998).

 

Các dịch chiết bằng hexane, ethyl acetate và methanol từ trái đều có những hoạt tính diệt được ký sinh trùng Leishmania braziliensis và L.panamensis (tác dụng này còn mạnh hơn cả chất Glucantime dùng làm tiêu chuẩn đối chiếu). Ngoài ra các acetogenins cô lập được annonacein, annonacin A và annomuricin A có các hoạt tính gây độc hại cho các tế bào ung thư dòng U-937 (Fitotherapia Số 71-2000).

 

Thử nghiệm tại Đại học Universidade Federal de Alagoas, Maceio-AL, Brazil ghi nhận dịch chiết từ lá bằng ethanol có khả năng diệt được nhuyến thể (ốc-sò) loài Biomphalaria glabrata ở nồng độ LD50 = 8.75 ppm, và có thêm đặc điểm là diệt được các tụ khối trứng của sên (Phytomedicine Số 8-2001).

 

Một lectin loại glycoproteine chứa 8% carbohydrate, ly trích từ hạt có hoạt tính kết tụ hồng huyết cầu của người, ngỗng, ngựa và gà, đồng thời ức chế được sự tăng trưởng của các nấm và mốc loại Fusarium oxysoporum, Fusarium solani và Colletotrichum musae (Journal of Protein Chemistry Số 22-2003)

 

-Mãng cầu xiêm có liên hệ với bệnh Parkinson:

 

Tại vùng West Indies thuộc Pháp, nhất là ở Guadaloupe có tình trạng xảy ra bất thường về con số các bệnh nhân bị bệnh Parkinson, loại kháng-levo dopa: những bệnh nhân này đều tiêu thụ một lượng cao, và trong một thời gian lâu dài soursop hay mãng cầu xiêm (A.muricata).

 

Những nghiên cứu sơ khởi trong năm 1999 (công bố trên tạp chí Lancet Số 354, ngày 23 tháng 10 năm 1999) trên 87 bệnh nhân đưa đến kết luận là rất có thể có sự liên hệ giữa dùng nhiều mãng cầu xiêm, vốn có chứa các alkaloids loại benzyltetrahydroisoquinoleine độc hại về thần kinh. Nhóm bệnh nhân có những triệu chứng Parkinson không chuyên biệt (atipycal), gồm 30 người dùng khá nhiều mãng cầu trong cách ăn uống hàng ngày.

 

Nghiên cứu sâu rộng hơn vào năm 2002, cũng tại Guadeloupe, nhằm vào nhóm bệnh nhân Parkinson (atypical) cho thấy khi tách riêng các tế bào thần kinh (neuron) loại mesencephalic dopaminergic và cấy trong môi trường có chứa dịch chiết toàn phần rễ mãng cầu xiêm, hoặc chứa các hoạt chất cô lập như coreximinine, reticuline, có các kết quả như sau: Sau 24 giờ tiếp xúc: 50% các tế bào thần kinh cấy bị suy thoái ở nồng độ 18 microg/ml dịch chiết toàn phần; 4.3 microg/ml coreximine và 100 microg/ml reticuline.

 

Nghiên cứu này đưa đến kết luận là những alkaloids trích từ mãng cầu xiêm có thể có tác dụng điều hợp chức năng cùng sự thay đổi để sinh tồn của các tế bào thần kinh dopaminergic trong các thử nghiệm ‘in vitro’; và rất có thể có những liên hệ tác hại giữa việc dùng mãng cầu xiêm ở lượng cao và liên tục với những suy thoái về tế bào thần kinh. Do đó bệnh nhân Parkinson, do yếu tố an toàn nên tránh ăn mãng cầu xiêm! (Movement Disorders Số 17-2002).

 

Độc tính và liều lượng:

 

Theo tài liệu của Herbal Secrets of the Rain Forest:

Liều trị liệu của lá (cũng chứa lượng acetrogenins khá cao, so với rễ và hạt) là 2-3 gram chia làm 3-4 lần/ngày. Trên thị trường Hoa Kỳ có một số chế phẩm, mang tên Graviola, dưới các dạng viên nang (capsule) và cồn thuốc (tincture).

  

Không nên dùng các chế phẩm làm từ lá, rễ và hạt mãng cầu xiêm (phần thịt của quả không bị hạn chế) trong các trường hợp:

 

- Có thai: do hoạt tính gây co thắt tử cung khi thử trên chuột.

- Huyết áp cao: Lá, rễ và hạt có tác dụng gây hạ huyết áp, ức chế tim, người dùng thuốc trị áp huyết cần bàn với BS điều trị.

- Khi dùng lâu dài các chế phẩm Graviola có thể gây các rối loạn về vi sinh vật trong đường ruột.

- Một số trường hợp bị ói mửa, buồn nôn khi dùng Graviola, trong trường hợp này nên giảm bớt liều sử dụng.

- Không nên dùng Graviola chung với CoEnzyme Q 10 (một trong những cơ chế hoạt động của acetogenins là ngăn chặn sự cung cấp ATP cho tế bào ung thư, và CoEnzym Q.10 là một chất cung cấp ATP), uống chung sẽ làm giảm công hiệu của cả 2 loại.

---------------------------------------------------------------------------

 

Annona muricata is a member of the family of Custard apple trees called Annonaceae and a species of the genus Annona known mostly for its edible fruits Anona. Annona muricata produces fruits that are usually called Soursop due to its slightly acidic taste when ripe. A. muricata trees grew natively in the Caribbean and Central America but are now widely cultivated and in some areas, escaping and living on their own in tropical climates throughout the world.

Common names

•English: Brazilian pawpaw, soursop, prickly custard apple, Soursapi

•Spanish: guanábana, guanábano, anona, catche, catoche, catuche, zapote agrio

•Chamorro: laguaná, laguana, laguanaha, syasyap

•German: Sauersack, Stachelannone, anona, flashendaum, stachel anone, stachliger

•Fijian: sarifa, seremaia

•French: anone muriquee, cachiman épineux, corossol épineux,anone, cachiman épineux, caichemantier, coeur de boeuf, corossol, corossolier, epineux

•Indonesian: sirsak

•Malay: Durian Belanda

•Māori: kātara‘apa, kātara‘apa papa‘ā, naponapo taratara

•Dutch: zuurzak

•Portuguese: graviola, araticum-grande, araticum-manso, coração-de-rainha, jaca-de-pobre, jaca-do-Pará, anona, curassol, graviola, pinha azeda

•Samoan: sanalapa, sasalapa, sasalapa

•Tahitian: tapotapo papa‘a, tapotapo urupe

•Vietnamese: mãng cầu Xiêm, mãng cầu gai

•Chinese: 刺果番荔枝

Description

Annona muricata is a small, upright, evergreen that can grow to about 4 metres (13 ft) tall and cannot stand frost.

Stems and leaves

The young branches are hairy.

Leaves are oblong to oval, 8 centimetres (3.1 in) to 16 centimetres (6.3 in) long and 3 centimetres (1.2 in) to 7 centimetres (2.8 in) wide. Glossy dark green with no hairs above, paler and minutely hairy to no hairs below.

The leaf stalks are 4 millimetres (0.16 in) to 13 millimetres (0.51 in) long and without hairs.

Flowers

Flower stalks (peduncles) are 2 millimetres (0.079 in) to 5 millimetres (0.20 in) long and woody. They appear opposite from the leaves or as an extra from near the leaf stalk, each with one or two flowers, occasionally a third.

Stalks for the individual flowers (pedicels) are stout and woody, minutely hairy to hairless and 15 millimetres (0.59 in) to 20 millimetres (0.79 in) with small bractlets nearer to the base which are densely hairy.

Petals are thick and yellowish. Outer petals meet at the edges without overlapping and are broadly ovate, 2.8 centimetres (1.1 in) to 3.3 centimetres (1.3 in) by 2.1 centimetres (0.83 in) to 2.5 centimetres (0.98 in), tapering to a point with a heart shaped base. Evenly thick, covered with long, slender, soft hairs externally and matted finely with soft hairs within. Inner petals are oval shaped and overlap. 2.5 centimetres (0.98 in) to 2.8 centimetres (1.1 in) by 2 centimetres (0.79 in). Sharply angled and tapering at the base. Margins are comparatively thin, with fine matted soft hairs on both sides. The receptacle is conical and hairy. Stamens 4.5 millimetres (0.18 in) long and narrowly wedge-shaped. The connective-tip terminate abruptly and anther hollows are unequal. Sepals are quite thick and do not overlap. Carpels are linear and basally growing from one base. The ovaries are covered with dense reddish brown hairs, 1-ovuled, style short and stigma truncate.

Fruits and reproduction

Dark green, prickly (or bristled) fruits are egg-shaped and can be up to 30 centimetres (12 in) long, with a moderately firm texture.[5] Flesh is juicy, acid, whitish and aromatic.

Abundant seeds the average weight of 1000 fresh seeds is 470 grams (17 oz) and had an average oil content of 24%. When dried for 3 days in 60 °C (140 °F) the average seed weight was 322 grams (11.4 oz) and were tolerant of the moisture extraction; showing no problems for long-term storage under reasonable conditions.

Distribution

Annona muricata is tolerant of poor soil and prefers lowland areas between the altitudes of 0 metres (0 ft) to 1,200 metres (3,900 ft).

Native

Neotropic:

Caribbean: Cuba, Jamaica, Trinidad and Tobago, Haiti, Puerto Rico

Central America: Costa Rica, El Salvador, Guatemala, Honduras, Mexico, Nicaragua, Panama, Belize

South America: Bolivia, Colombia, Venezuela, Ecuador[4

  

Several live Chinese Hamster Ovary (CHO) cells in vitro as viewed through a phase contrast microscope. Visible in the photo are nuclei, nucleoli mitochondria, and the cell boundary defined by the plasma membrane as well as other yet to be identified cellular structures.

 

For the next few weeks I will be working with these Chinese Hamster Ovary (CHO) cells in my Molecular Cell Biology course at MTSU. You are looking at an original picture of a group of these cells that we photographed using laboratory equipment (this is not a copy of an image from another source.) These are wild type CHO-K1 cells, the original cell line of which was started in 1957 by T.T. Puck. These cells grow in a monolayer on the bottom of the culture flask. CHO cells are commonly used in biological, genetics and medical research.

 

Using phase contrast microscopy allows the cells to be viewed live with out traditional staining which requires that the cells be fixed and results in quietus of the organism. Since the cells are living during observation, movement and activity of subcellular components can be easily viewed.

Before you all write in and tell me that I've misplaced the apostrophe take some time to reflect on Mother's Day.

 

Overly simplistic and terribly popular is the notion that you are the sum of your parent's DNA, 50:50. Even if that were true, and it's not, there's a little surprise for you hidden in the cellular machinery of your mitochondria. These little buggers floating about in your cells do all the chemical work to provide you with energy. Whatever other DNA you have inherited, 100 per cent of you mitochondrial DNA (mDNA) came from your mother. Your paternal parent my have donated a shed load of sperm and gallons of semen when you were conceived. But not one of those little wigglers had any space left over for much mitochondria. As always, your mother did all the hard work to sustain you.

 

Synthesising this idea, you got your mDNA from your mother, and she from hers all the way back to our first mother, the so-called Mitochondrial Eve. This isn't some pseudo-science support for Judeo-Christian mythology. It's just that most people get the symbolism of a first mother…and some call her Eve. Taking Occam's Razor to the supposition that the Judeo-Christian Eve was the first and only mother leads you to suppose that no other faith could replicate. Clearly they do. Clearly Adam & Eve as anything more than faith-based mythology is BS.

 

You know the answer to the chicken and egg problem, don't you? That's the question of which came first, the chicken or the egg. Logic demands that it was the egg. What came out of the egg was a chicken. What laid the egg was not. That is unless you are one of those with blind faith in mythology and someone who eschews science. This COVID-19 scenario we are presently in was soundly predicted and modelled by science. It was rejected by faith. Let's see how that's working out for the good ol' US of A. If nothing else, this pandemic should be telling you that science trumps faith, no matter what you believe.

 

Oops, back to Mothers' Day and that apostrophe. You are the sum of your maternal line more than anything else. Don't just celebrate your mother today. Commemorate all that made you. Your paternal grandmother did it for your father. But the women in your maternal line are the powerhouses who made so much more of you than did your father. So, today I'll reflect on Mary, Ivy, Margaret, Eliza, Eliza, Mary and Ann…

 

Not only were these women the powerhouses of your past, they were the glue that kept it all together. They were the wise old birds who more often than not didn't get the recognition and reward they deserved. Today, and all days, we should reflect on mothers and women, whether mothers or not, who hold up half the sky while carrying a baby on one hip, her breasts delivering nourishment, its lips to her nipple, comforting. She is quite likely incubating another, tutoring one, chastising another, kneading bread with the free hand, feeding and clothing at least one generation; maybe more. Goodness knows where she's holding the broom while she sweeps the floor!

 

The COVID-19 pandemic ruined Chinese New Year, Passover, Easter, now Ramadan . May Day passed with barely a mention for the down trodden workers left to fend for themselves in a rotting capitalist system turned inwards by this virus. Don't let it spoil Mother's Day too. Instead, use it to turn what is often a marketing opportunity into a deep, reflective reimagining of Mother's Day into Mothers' Day.

 

...for more radness, check out www.killertimes.com

Confocal and brightfield microscope images of live human cells imaged for ~18 hours.

 

These cells are a human cancer cell line. Some of them are expressing a fluorescent protein which stains the nucleus (shown pinkish red). The cell which starts in the centre bottom position with a red nucleus undergoes mitosis (cell division) about 2/5th of the way through. There are other cells in the field which also divide, but this one is nice and obvious because of the nucleus stain.

 

For division, the cell has to have already copied it's chromosomes, and then disassemble the nuclear membrane, then sort it's chromosomes to correctly separate the pairs into two new daughter cells, which then have to reassemble their nuclear membranes and separate their plasma (outer) membranes. All quite a feat really. Its the nuclear separation that is nice and clear in this video.

 

I have added another video of cell division here in which I've tagged the mitochondria.

 

Image capture on a temperature, CO2 and humidity controlled stage of a Zeiss LSM510 using minimal light input to obtain fluorescence from the fluorescent protein.

 

Movie created from a subportion of the whole field and rendered as an rgb avi in ImageJ.

 

t19d_53bp1_20x_resting_L1_zoom1_flickr

Mitochondria in an aboriginal style. Acrylic on canvas, by C. Michael Gibson.

The mitochondria is the representative sample of the theory of endosymbiosis

mentioned by Lynn Margulis 50 years ago (Lynn Sagan; On The Origin of Mitosing Cell,

J Theoret Biol 1967 14, 225-274), is one of the most evolved energy generators.

 

A TEM with tomography holder was used, the tissue used is rat kidney, the

Mitochondria are taken from epithelial cells of the Proximal Tubule

processed conventionally for TEM with a cut of 120nm. The 3D image of

Ultrastructural tomography was integrated from the inclination of the holder. The white color of the 3D image shows the spaces

empty of the mitochondrial crests, the red color shows the external part of the mitochondria and the inner mitochondrial membrane forming the mitochondrial crests.

 

Courtesy of Prof. JUAN CARLOS LEON-CONTRERAS , INCMNSZ

 

Image Details

Instrument used: Tecnai

Magnification: 23,000x

Voltage: 80 kV

Spot: 2.0

 

The single peperoni slice is the inner core, kalmata olives are the outer core, mushrooms, cheese and sauce are the mantle and the crust is, of course, the crust!

 

I believe this was the first effort from our child and a classmate. It was eaten promptly. Delicious, I promise you. Makes me want to go home and make another!

 

IMG_5218

Multispectral confocal microscopy of a fibroblast cell expressing fluorescent proteins targeted to organelles: lysosomes, mitochondria, endoplastmic reticulum, peroxisomes, Golgi, and lipid droplets. Scale bar, 10 µm.

 

Credit: A. Valm, S. Cohen, J. Lippincott-Schwartz, National Institute of Child Health and Human Development, National Institutes of Health

A fungus (pl.: fungi or funguses) is any member of the group of eukaryotic organisms that includes microorganisms such as yeasts and molds, as well as the more familiar mushrooms. These organisms are classified as one of the traditional eukaryotic kingdoms, along with Animalia, Plantae and either Protista or Protozoa and Chromista.

 

A characteristic that places fungi in a different kingdom from plants, bacteria, and some protists is chitin in their cell walls. Fungi, like animals, are heterotrophs; they acquire their food by absorbing dissolved molecules, typically by secreting digestive enzymes into their environment. Fungi do not photosynthesize. Growth is their means of mobility, except for spores (a few of which are flagellated), which may travel through the air or water. Fungi are the principal decomposers in ecological systems. These and other differences place fungi in a single group of related organisms, named the Eumycota (true fungi or Eumycetes), that share a common ancestor (i.e. they form a monophyletic group), an interpretation that is also strongly supported by molecular phylogenetics. This fungal group is distinct from the structurally similar myxomycetes (slime molds) and oomycetes (water molds). The discipline of biology devoted to the study of fungi is known as mycology (from the Greek μύκης mykes, mushroom). In the past mycology was regarded as a branch of botany, although it is now known that fungi are genetically more closely related to animals than to plants.

 

Abundant worldwide, most fungi are inconspicuous because of the small size of their structures, and their cryptic lifestyles in soil or on dead matter. Fungi include symbionts of plants, animals, or other fungi and also parasites. They may become noticeable when fruiting, either as mushrooms or as molds. Fungi perform an essential role in the decomposition of organic matter and have fundamental roles in nutrient cycling and exchange in the environment. They have long been used as a direct source of human food, in the form of mushrooms and truffles; as a leavening agent for bread; and in the fermentation of various food products, such as wine, beer, and soy sauce. Since the 1940s, fungi have been used for the production of antibiotics, and, more recently, various enzymes produced by fungi are used industrially and in detergents. Fungi are also used as biological pesticides to control weeds, plant diseases, and insect pests. Many species produce bioactive compounds called mycotoxins, such as alkaloids and polyketides, that are toxic to animals, including humans. The fruiting structures of a few species contain psychotropic compounds and are consumed recreationally or in traditional spiritual ceremonies. Fungi can break down manufactured materials and buildings, and become significant pathogens of humans and other animals. Losses of crops due to fungal diseases (e.g., rice blast disease) or food spoilage can have a large impact on human food supplies and local economies.

 

The fungus kingdom encompasses an enormous diversity of taxa with varied ecologies, life cycle strategies, and morphologies ranging from unicellular aquatic chytrids to large mushrooms. However, little is known of the true biodiversity of the fungus kingdom, which has been estimated at 2.2 million to 3.8 million species. Of these, only about 148,000 have been described, with over 8,000 species known to be detrimental to plants and at least 300 that can be pathogenic to humans. Ever since the pioneering 18th and 19th century taxonomical works of Carl Linnaeus, Christiaan Hendrik Persoon, and Elias Magnus Fries, fungi have been classified according to their morphology (e.g., characteristics such as spore color or microscopic features) or physiology. Advances in molecular genetics have opened the way for DNA analysis to be incorporated into taxonomy, which has sometimes challenged the historical groupings based on morphology and other traits. Phylogenetic studies published in the first decade of the 21st century have helped reshape the classification within the fungi kingdom, which is divided into one subkingdom, seven phyla, and ten subphyla.

 

Etymology

The English word fungus is directly adopted from the Latin fungus (mushroom), used in the writings of Horace and Pliny. This in turn is derived from the Greek word sphongos (σφόγγος 'sponge'), which refers to the macroscopic structures and morphology of mushrooms and molds; the root is also used in other languages, such as the German Schwamm ('sponge') and Schimmel ('mold').

 

The word mycology is derived from the Greek mykes (μύκης 'mushroom') and logos (λόγος 'discourse'). It denotes the scientific study of fungi. The Latin adjectival form of "mycology" (mycologicæ) appeared as early as 1796 in a book on the subject by Christiaan Hendrik Persoon. The word appeared in English as early as 1824 in a book by Robert Kaye Greville. In 1836 the English naturalist Miles Joseph Berkeley's publication The English Flora of Sir James Edward Smith, Vol. 5. also refers to mycology as the study of fungi.

 

A group of all the fungi present in a particular region is known as mycobiota (plural noun, no singular). The term mycota is often used for this purpose, but many authors use it as a synonym of Fungi. The word funga has been proposed as a less ambiguous term morphologically similar to fauna and flora. The Species Survival Commission (SSC) of the International Union for Conservation of Nature (IUCN) in August 2021 asked that the phrase fauna and flora be replaced by fauna, flora, and funga.

 

Characteristics

 

Fungal hyphae cells

Hyphal wall

Septum

Mitochondrion

Vacuole

Ergosterol crystal

Ribosome

Nucleus

Endoplasmic reticulum

Lipid body

Plasma membrane

Spitzenkörper

Golgi apparatus

 

Fungal cell cycle showing Dikaryons typical of Higher Fungi

Before the introduction of molecular methods for phylogenetic analysis, taxonomists considered fungi to be members of the plant kingdom because of similarities in lifestyle: both fungi and plants are mainly immobile, and have similarities in general morphology and growth habitat. Although inaccurate, the common misconception that fungi are plants persists among the general public due to their historical classification, as well as several similarities. Like plants, fungi often grow in soil and, in the case of mushrooms, form conspicuous fruit bodies, which sometimes resemble plants such as mosses. The fungi are now considered a separate kingdom, distinct from both plants and animals, from which they appear to have diverged around one billion years ago (around the start of the Neoproterozoic Era). Some morphological, biochemical, and genetic features are shared with other organisms, while others are unique to the fungi, clearly separating them from the other kingdoms:

 

With other eukaryotes: Fungal cells contain membrane-bound nuclei with chromosomes that contain DNA with noncoding regions called introns and coding regions called exons. Fungi have membrane-bound cytoplasmic organelles such as mitochondria, sterol-containing membranes, and ribosomes of the 80S type. They have a characteristic range of soluble carbohydrates and storage compounds, including sugar alcohols (e.g., mannitol), disaccharides, (e.g., trehalose), and polysaccharides (e.g., glycogen, which is also found in animals).

With animals: Fungi lack chloroplasts and are heterotrophic organisms and so require preformed organic compounds as energy sources.

With plants: Fungi have a cell wall and vacuoles. They reproduce by both sexual and asexual means, and like basal plant groups (such as ferns and mosses) produce spores. Similar to mosses and algae, fungi typically have haploid nuclei.

With euglenoids and bacteria: Higher fungi, euglenoids, and some bacteria produce the amino acid L-lysine in specific biosynthesis steps, called the α-aminoadipate pathway.

The cells of most fungi grow as tubular, elongated, and thread-like (filamentous) structures called hyphae, which may contain multiple nuclei and extend by growing at their tips. Each tip contains a set of aggregated vesicles—cellular structures consisting of proteins, lipids, and other organic molecules—called the Spitzenkörper. Both fungi and oomycetes grow as filamentous hyphal cells. In contrast, similar-looking organisms, such as filamentous green algae, grow by repeated cell division within a chain of cells. There are also single-celled fungi (yeasts) that do not form hyphae, and some fungi have both hyphal and yeast forms.

In common with some plant and animal species, more than one hundred fungal species display bioluminescence.

Unique features:

 

Some species grow as unicellular yeasts that reproduce by budding or fission. Dimorphic fungi can switch between a yeast phase and a hyphal phase in response to environmental conditions.

The fungal cell wall is made of a chitin-glucan complex; while glucans are also found in plants and chitin in the exoskeleton of arthropods, fungi are the only organisms that combine these two structural molecules in their cell wall. Unlike those of plants and oomycetes, fungal cell walls do not contain cellulose.

A whitish fan or funnel-shaped mushroom growing at the base of a tree.

Omphalotus nidiformis, a bioluminescent mushroom

Most fungi lack an efficient system for the long-distance transport of water and nutrients, such as the xylem and phloem in many plants. To overcome this limitation, some fungi, such as Armillaria, form rhizomorphs, which resemble and perform functions similar to the roots of plants. As eukaryotes, fungi possess a biosynthetic pathway for producing terpenes that uses mevalonic acid and pyrophosphate as chemical building blocks. Plants and some other organisms have an additional terpene biosynthesis pathway in their chloroplasts, a structure that fungi and animals do not have. Fungi produce several secondary metabolites that are similar or identical in structure to those made by plants. Many of the plant and fungal enzymes that make these compounds differ from each other in sequence and other characteristics, which indicates separate origins and convergent evolution of these enzymes in the fungi and plants.

 

Diversity

Fungi have a worldwide distribution, and grow in a wide range of habitats, including extreme environments such as deserts or areas with high salt concentrations or ionizing radiation, as well as in deep sea sediments. Some can survive the intense UV and cosmic radiation encountered during space travel. Most grow in terrestrial environments, though several species live partly or solely in aquatic habitats, such as the chytrid fungi Batrachochytrium dendrobatidis and B. salamandrivorans, parasites that have been responsible for a worldwide decline in amphibian populations. These organisms spend part of their life cycle as a motile zoospore, enabling them to propel itself through water and enter their amphibian host. Other examples of aquatic fungi include those living in hydrothermal areas of the ocean.

 

As of 2020, around 148,000 species of fungi have been described by taxonomists, but the global biodiversity of the fungus kingdom is not fully understood. A 2017 estimate suggests there may be between 2.2 and 3.8 million species The number of new fungi species discovered yearly has increased from 1,000 to 1,500 per year about 10 years ago, to about 2000 with a peak of more than 2,500 species in 2016. In the year 2019, 1882 new species of fungi were described, and it was estimated that more than 90% of fungi remain unknown The following year, 2905 new species were described—the highest annual record of new fungus names. In mycology, species have historically been distinguished by a variety of methods and concepts. Classification based on morphological characteristics, such as the size and shape of spores or fruiting structures, has traditionally dominated fungal taxonomy. Species may also be distinguished by their biochemical and physiological characteristics, such as their ability to metabolize certain biochemicals, or their reaction to chemical tests. The biological species concept discriminates species based on their ability to mate. The application of molecular tools, such as DNA sequencing and phylogenetic analysis, to study diversity has greatly enhanced the resolution and added robustness to estimates of genetic diversity within various taxonomic groups.

 

Mycology

Mycology is the branch of biology concerned with the systematic study of fungi, including their genetic and biochemical properties, their taxonomy, and their use to humans as a source of medicine, food, and psychotropic substances consumed for religious purposes, as well as their dangers, such as poisoning or infection. The field of phytopathology, the study of plant diseases, is closely related because many plant pathogens are fungi.

 

The use of fungi by humans dates back to prehistory; Ötzi the Iceman, a well-preserved mummy of a 5,300-year-old Neolithic man found frozen in the Austrian Alps, carried two species of polypore mushrooms that may have been used as tinder (Fomes fomentarius), or for medicinal purposes (Piptoporus betulinus). Ancient peoples have used fungi as food sources—often unknowingly—for millennia, in the preparation of leavened bread and fermented juices. Some of the oldest written records contain references to the destruction of crops that were probably caused by pathogenic fungi.

 

History

Mycology became a systematic science after the development of the microscope in the 17th century. Although fungal spores were first observed by Giambattista della Porta in 1588, the seminal work in the development of mycology is considered to be the publication of Pier Antonio Micheli's 1729 work Nova plantarum genera. Micheli not only observed spores but also showed that, under the proper conditions, they could be induced into growing into the same species of fungi from which they originated. Extending the use of the binomial system of nomenclature introduced by Carl Linnaeus in his Species plantarum (1753), the Dutch Christiaan Hendrik Persoon (1761–1836) established the first classification of mushrooms with such skill as to be considered a founder of modern mycology. Later, Elias Magnus Fries (1794–1878) further elaborated the classification of fungi, using spore color and microscopic characteristics, methods still used by taxonomists today. Other notable early contributors to mycology in the 17th–19th and early 20th centuries include Miles Joseph Berkeley, August Carl Joseph Corda, Anton de Bary, the brothers Louis René and Charles Tulasne, Arthur H. R. Buller, Curtis G. Lloyd, and Pier Andrea Saccardo. In the 20th and 21st centuries, advances in biochemistry, genetics, molecular biology, biotechnology, DNA sequencing and phylogenetic analysis has provided new insights into fungal relationships and biodiversity, and has challenged traditional morphology-based groupings in fungal taxonomy.

 

Morphology

Microscopic structures

Monochrome micrograph showing Penicillium hyphae as long, transparent, tube-like structures a few micrometres across. Conidiophores branch out laterally from the hyphae, terminating in bundles of phialides on which spherical condidiophores are arranged like beads on a string. Septa are faintly visible as dark lines crossing the hyphae.

An environmental isolate of Penicillium

Hypha

Conidiophore

Phialide

Conidia

Septa

Most fungi grow as hyphae, which are cylindrical, thread-like structures 2–10 µm in diameter and up to several centimeters in length. Hyphae grow at their tips (apices); new hyphae are typically formed by emergence of new tips along existing hyphae by a process called branching, or occasionally growing hyphal tips fork, giving rise to two parallel-growing hyphae. Hyphae also sometimes fuse when they come into contact, a process called hyphal fusion (or anastomosis). These growth processes lead to the development of a mycelium, an interconnected network of hyphae. Hyphae can be either septate or coenocytic. Septate hyphae are divided into compartments separated by cross walls (internal cell walls, called septa, that are formed at right angles to the cell wall giving the hypha its shape), with each compartment containing one or more nuclei; coenocytic hyphae are not compartmentalized. Septa have pores that allow cytoplasm, organelles, and sometimes nuclei to pass through; an example is the dolipore septum in fungi of the phylum Basidiomycota. Coenocytic hyphae are in essence multinucleate supercells.

 

Many species have developed specialized hyphal structures for nutrient uptake from living hosts; examples include haustoria in plant-parasitic species of most fungal phyla,[63] and arbuscules of several mycorrhizal fungi, which penetrate into the host cells to consume nutrients.

 

Although fungi are opisthokonts—a grouping of evolutionarily related organisms broadly characterized by a single posterior flagellum—all phyla except for the chytrids have lost their posterior flagella. Fungi are unusual among the eukaryotes in having a cell wall that, in addition to glucans (e.g., β-1,3-glucan) and other typical components, also contains the biopolymer chitin.

 

Macroscopic structures

Fungal mycelia can become visible to the naked eye, for example, on various surfaces and substrates, such as damp walls and spoiled food, where they are commonly called molds. Mycelia grown on solid agar media in laboratory petri dishes are usually referred to as colonies. These colonies can exhibit growth shapes and colors (due to spores or pigmentation) that can be used as diagnostic features in the identification of species or groups. Some individual fungal colonies can reach extraordinary dimensions and ages as in the case of a clonal colony of Armillaria solidipes, which extends over an area of more than 900 ha (3.5 square miles), with an estimated age of nearly 9,000 years.

 

The apothecium—a specialized structure important in sexual reproduction in the ascomycetes—is a cup-shaped fruit body that is often macroscopic and holds the hymenium, a layer of tissue containing the spore-bearing cells. The fruit bodies of the basidiomycetes (basidiocarps) and some ascomycetes can sometimes grow very large, and many are well known as mushrooms.

 

Growth and physiology

Time-lapse photography sequence of a peach becoming progressively discolored and disfigured

Mold growth covering a decaying peach. The frames were taken approximately 12 hours apart over a period of six days.

The growth of fungi as hyphae on or in solid substrates or as single cells in aquatic environments is adapted for the efficient extraction of nutrients, because these growth forms have high surface area to volume ratios. Hyphae are specifically adapted for growth on solid surfaces, and to invade substrates and tissues. They can exert large penetrative mechanical forces; for example, many plant pathogens, including Magnaporthe grisea, form a structure called an appressorium that evolved to puncture plant tissues.[71] The pressure generated by the appressorium, directed against the plant epidermis, can exceed 8 megapascals (1,200 psi).[71] The filamentous fungus Paecilomyces lilacinus uses a similar structure to penetrate the eggs of nematodes.

 

The mechanical pressure exerted by the appressorium is generated from physiological processes that increase intracellular turgor by producing osmolytes such as glycerol. Adaptations such as these are complemented by hydrolytic enzymes secreted into the environment to digest large organic molecules—such as polysaccharides, proteins, and lipids—into smaller molecules that may then be absorbed as nutrients. The vast majority of filamentous fungi grow in a polar fashion (extending in one direction) by elongation at the tip (apex) of the hypha. Other forms of fungal growth include intercalary extension (longitudinal expansion of hyphal compartments that are below the apex) as in the case of some endophytic fungi, or growth by volume expansion during the development of mushroom stipes and other large organs. Growth of fungi as multicellular structures consisting of somatic and reproductive cells—a feature independently evolved in animals and plants—has several functions, including the development of fruit bodies for dissemination of sexual spores (see above) and biofilms for substrate colonization and intercellular communication.

 

Fungi are traditionally considered heterotrophs, organisms that rely solely on carbon fixed by other organisms for metabolism. Fungi have evolved a high degree of metabolic versatility that allows them to use a diverse range of organic substrates for growth, including simple compounds such as nitrate, ammonia, acetate, or ethanol. In some species the pigment melanin may play a role in extracting energy from ionizing radiation, such as gamma radiation. This form of "radiotrophic" growth has been described for only a few species, the effects on growth rates are small, and the underlying biophysical and biochemical processes are not well known. This process might bear similarity to CO2 fixation via visible light, but instead uses ionizing radiation as a source of energy.

 

Reproduction

Two thickly stemmed brownish mushrooms with scales on the upper surface, growing out of a tree trunk

Polyporus squamosus

Fungal reproduction is complex, reflecting the differences in lifestyles and genetic makeup within this diverse kingdom of organisms. It is estimated that a third of all fungi reproduce using more than one method of propagation; for example, reproduction may occur in two well-differentiated stages within the life cycle of a species, the teleomorph (sexual reproduction) and the anamorph (asexual reproduction). Environmental conditions trigger genetically determined developmental states that lead to the creation of specialized structures for sexual or asexual reproduction. These structures aid reproduction by efficiently dispersing spores or spore-containing propagules.

 

Asexual reproduction

Asexual reproduction occurs via vegetative spores (conidia) or through mycelial fragmentation. Mycelial fragmentation occurs when a fungal mycelium separates into pieces, and each component grows into a separate mycelium. Mycelial fragmentation and vegetative spores maintain clonal populations adapted to a specific niche, and allow more rapid dispersal than sexual reproduction. The "Fungi imperfecti" (fungi lacking the perfect or sexual stage) or Deuteromycota comprise all the species that lack an observable sexual cycle. Deuteromycota (alternatively known as Deuteromycetes, conidial fungi, or mitosporic fungi) is not an accepted taxonomic clade and is now taken to mean simply fungi that lack a known sexual stage.

 

Sexual reproduction

See also: Mating in fungi and Sexual selection in fungi

Sexual reproduction with meiosis has been directly observed in all fungal phyla except Glomeromycota (genetic analysis suggests meiosis in Glomeromycota as well). It differs in many aspects from sexual reproduction in animals or plants. Differences also exist between fungal groups and can be used to discriminate species by morphological differences in sexual structures and reproductive strategies. Mating experiments between fungal isolates may identify species on the basis of biological species concepts. The major fungal groupings have initially been delineated based on the morphology of their sexual structures and spores; for example, the spore-containing structures, asci and basidia, can be used in the identification of ascomycetes and basidiomycetes, respectively. Fungi employ two mating systems: heterothallic species allow mating only between individuals of the opposite mating type, whereas homothallic species can mate, and sexually reproduce, with any other individual or itself.

 

Most fungi have both a haploid and a diploid stage in their life cycles. In sexually reproducing fungi, compatible individuals may combine by fusing their hyphae together into an interconnected network; this process, anastomosis, is required for the initiation of the sexual cycle. Many ascomycetes and basidiomycetes go through a dikaryotic stage, in which the nuclei inherited from the two parents do not combine immediately after cell fusion, but remain separate in the hyphal cells (see heterokaryosis).

 

In ascomycetes, dikaryotic hyphae of the hymenium (the spore-bearing tissue layer) form a characteristic hook (crozier) at the hyphal septum. During cell division, the formation of the hook ensures proper distribution of the newly divided nuclei into the apical and basal hyphal compartments. An ascus (plural asci) is then formed, in which karyogamy (nuclear fusion) occurs. Asci are embedded in an ascocarp, or fruiting body. Karyogamy in the asci is followed immediately by meiosis and the production of ascospores. After dispersal, the ascospores may germinate and form a new haploid mycelium.

 

Sexual reproduction in basidiomycetes is similar to that of the ascomycetes. Compatible haploid hyphae fuse to produce a dikaryotic mycelium. However, the dikaryotic phase is more extensive in the basidiomycetes, often also present in the vegetatively growing mycelium. A specialized anatomical structure, called a clamp connection, is formed at each hyphal septum. As with the structurally similar hook in the ascomycetes, the clamp connection in the basidiomycetes is required for controlled transfer of nuclei during cell division, to maintain the dikaryotic stage with two genetically different nuclei in each hyphal compartment. A basidiocarp is formed in which club-like structures known as basidia generate haploid basidiospores after karyogamy and meiosis. The most commonly known basidiocarps are mushrooms, but they may also take other forms (see Morphology section).

 

In fungi formerly classified as Zygomycota, haploid hyphae of two individuals fuse, forming a gametangium, a specialized cell structure that becomes a fertile gamete-producing cell. The gametangium develops into a zygospore, a thick-walled spore formed by the union of gametes. When the zygospore germinates, it undergoes meiosis, generating new haploid hyphae, which may then form asexual sporangiospores. These sporangiospores allow the fungus to rapidly disperse and germinate into new genetically identical haploid fungal mycelia.

 

Spore dispersal

The spores of most of the researched species of fungi are transported by wind. Such species often produce dry or hydrophobic spores that do not absorb water and are readily scattered by raindrops, for example. In other species, both asexual and sexual spores or sporangiospores are often actively dispersed by forcible ejection from their reproductive structures. This ejection ensures exit of the spores from the reproductive structures as well as traveling through the air over long distances.

 

Specialized mechanical and physiological mechanisms, as well as spore surface structures (such as hydrophobins), enable efficient spore ejection. For example, the structure of the spore-bearing cells in some ascomycete species is such that the buildup of substances affecting cell volume and fluid balance enables the explosive discharge of spores into the air. The forcible discharge of single spores termed ballistospores involves formation of a small drop of water (Buller's drop), which upon contact with the spore leads to its projectile release with an initial acceleration of more than 10,000 g; the net result is that the spore is ejected 0.01–0.02 cm, sufficient distance for it to fall through the gills or pores into the air below. Other fungi, like the puffballs, rely on alternative mechanisms for spore release, such as external mechanical forces. The hydnoid fungi (tooth fungi) produce spores on pendant, tooth-like or spine-like projections. The bird's nest fungi use the force of falling water drops to liberate the spores from cup-shaped fruiting bodies. Another strategy is seen in the stinkhorns, a group of fungi with lively colors and putrid odor that attract insects to disperse their spores.

 

Homothallism

In homothallic sexual reproduction, two haploid nuclei derived from the same individual fuse to form a zygote that can then undergo meiosis. Homothallic fungi include species with an Aspergillus-like asexual stage (anamorphs) occurring in numerous different genera, several species of the ascomycete genus Cochliobolus, and the ascomycete Pneumocystis jirovecii. The earliest mode of sexual reproduction among eukaryotes was likely homothallism, that is, self-fertile unisexual reproduction.

 

Other sexual processes

Besides regular sexual reproduction with meiosis, certain fungi, such as those in the genera Penicillium and Aspergillus, may exchange genetic material via parasexual processes, initiated by anastomosis between hyphae and plasmogamy of fungal cells. The frequency and relative importance of parasexual events is unclear and may be lower than other sexual processes. It is known to play a role in intraspecific hybridization and is likely required for hybridization between species, which has been associated with major events in fungal evolution.

 

Evolution

In contrast to plants and animals, the early fossil record of the fungi is meager. Factors that likely contribute to the under-representation of fungal species among fossils include the nature of fungal fruiting bodies, which are soft, fleshy, and easily degradable tissues and the microscopic dimensions of most fungal structures, which therefore are not readily evident. Fungal fossils are difficult to distinguish from those of other microbes, and are most easily identified when they resemble extant fungi. Often recovered from a permineralized plant or animal host, these samples are typically studied by making thin-section preparations that can be examined with light microscopy or transmission electron microscopy. Researchers study compression fossils by dissolving the surrounding matrix with acid and then using light or scanning electron microscopy to examine surface details.

 

The earliest fossils possessing features typical of fungi date to the Paleoproterozoic era, some 2,400 million years ago (Ma); these multicellular benthic organisms had filamentous structures capable of anastomosis. Other studies (2009) estimate the arrival of fungal organisms at about 760–1060 Ma on the basis of comparisons of the rate of evolution in closely related groups. The oldest fossilizied mycelium to be identified from its molecular composition is between 715 and 810 million years old. For much of the Paleozoic Era (542–251 Ma), the fungi appear to have been aquatic and consisted of organisms similar to the extant chytrids in having flagellum-bearing spores. The evolutionary adaptation from an aquatic to a terrestrial lifestyle necessitated a diversification of ecological strategies for obtaining nutrients, including parasitism, saprobism, and the development of mutualistic relationships such as mycorrhiza and lichenization. Studies suggest that the ancestral ecological state of the Ascomycota was saprobism, and that independent lichenization events have occurred multiple times.

 

In May 2019, scientists reported the discovery of a fossilized fungus, named Ourasphaira giraldae, in the Canadian Arctic, that may have grown on land a billion years ago, well before plants were living on land. Pyritized fungus-like microfossils preserved in the basal Ediacaran Doushantuo Formation (~635 Ma) have been reported in South China. Earlier, it had been presumed that the fungi colonized the land during the Cambrian (542–488.3 Ma), also long before land plants. Fossilized hyphae and spores recovered from the Ordovician of Wisconsin (460 Ma) resemble modern-day Glomerales, and existed at a time when the land flora likely consisted of only non-vascular bryophyte-like plants. Prototaxites, which was probably a fungus or lichen, would have been the tallest organism of the late Silurian and early Devonian. Fungal fossils do not become common and uncontroversial until the early Devonian (416–359.2 Ma), when they occur abundantly in the Rhynie chert, mostly as Zygomycota and Chytridiomycota. At about this same time, approximately 400 Ma, the Ascomycota and Basidiomycota diverged, and all modern classes of fungi were present by the Late Carboniferous (Pennsylvanian, 318.1–299 Ma).

 

Lichens formed a component of the early terrestrial ecosystems, and the estimated age of the oldest terrestrial lichen fossil is 415 Ma; this date roughly corresponds to the age of the oldest known sporocarp fossil, a Paleopyrenomycites species found in the Rhynie Chert. The oldest fossil with microscopic features resembling modern-day basidiomycetes is Palaeoancistrus, found permineralized with a fern from the Pennsylvanian. Rare in the fossil record are the Homobasidiomycetes (a taxon roughly equivalent to the mushroom-producing species of the Agaricomycetes). Two amber-preserved specimens provide evidence that the earliest known mushroom-forming fungi (the extinct species Archaeomarasmius leggetti) appeared during the late Cretaceous, 90 Ma.

 

Some time after the Permian–Triassic extinction event (251.4 Ma), a fungal spike (originally thought to be an extraordinary abundance of fungal spores in sediments) formed, suggesting that fungi were the dominant life form at this time, representing nearly 100% of the available fossil record for this period. However, the relative proportion of fungal spores relative to spores formed by algal species is difficult to assess, the spike did not appear worldwide, and in many places it did not fall on the Permian–Triassic boundary.

 

Sixty-five million years ago, immediately after the Cretaceous–Paleogene extinction event that famously killed off most dinosaurs, there was a dramatic increase in evidence of fungi; apparently the death of most plant and animal species led to a huge fungal bloom like "a massive compost heap".

 

Taxonomy

Although commonly included in botany curricula and textbooks, fungi are more closely related to animals than to plants and are placed with the animals in the monophyletic group of opisthokonts. Analyses using molecular phylogenetics support a monophyletic origin of fungi. The taxonomy of fungi is in a state of constant flux, especially due to research based on DNA comparisons. These current phylogenetic analyses often overturn classifications based on older and sometimes less discriminative methods based on morphological features and biological species concepts obtained from experimental matings.

 

There is no unique generally accepted system at the higher taxonomic levels and there are frequent name changes at every level, from species upwards. Efforts among researchers are now underway to establish and encourage usage of a unified and more consistent nomenclature. Until relatively recent (2012) changes to the International Code of Nomenclature for algae, fungi and plants, fungal species could also have multiple scientific names depending on their life cycle and mode (sexual or asexual) of reproduction. Web sites such as Index Fungorum and MycoBank are officially recognized nomenclatural repositories and list current names of fungal species (with cross-references to older synonyms).

 

The 2007 classification of Kingdom Fungi is the result of a large-scale collaborative research effort involving dozens of mycologists and other scientists working on fungal taxonomy. It recognizes seven phyla, two of which—the Ascomycota and the Basidiomycota—are contained within a branch representing subkingdom Dikarya, the most species rich and familiar group, including all the mushrooms, most food-spoilage molds, most plant pathogenic fungi, and the beer, wine, and bread yeasts. The accompanying cladogram depicts the major fungal taxa and their relationship to opisthokont and unikont organisms, based on the work of Philippe Silar, "The Mycota: A Comprehensive Treatise on Fungi as Experimental Systems for Basic and Applied Research" and Tedersoo et al. 2018. The lengths of the branches are not proportional to evolutionary distances.

 

The major phyla (sometimes called divisions) of fungi have been classified mainly on the basis of characteristics of their sexual reproductive structures. As of 2019, nine major lineages have been identified: Opisthosporidia, Chytridiomycota, Neocallimastigomycota, Blastocladiomycota, Zoopagomycotina, Mucoromycota, Glomeromycota, Ascomycota and Basidiomycota.

 

Phylogenetic analysis has demonstrated that the Microsporidia, unicellular parasites of animals and protists, are fairly recent and highly derived endobiotic fungi (living within the tissue of another species). Previously considered to be "primitive" protozoa, they are now thought to be either a basal branch of the Fungi, or a sister group–each other's closest evolutionary relative.

 

The Chytridiomycota are commonly known as chytrids. These fungi are distributed worldwide. Chytrids and their close relatives Neocallimastigomycota and Blastocladiomycota (below) are the only fungi with active motility, producing zoospores that are capable of active movement through aqueous phases with a single flagellum, leading early taxonomists to classify them as protists. Molecular phylogenies, inferred from rRNA sequences in ribosomes, suggest that the Chytrids are a basal group divergent from the other fungal phyla, consisting of four major clades with suggestive evidence for paraphyly or possibly polyphyly.

 

The Blastocladiomycota were previously considered a taxonomic clade within the Chytridiomycota. Molecular data and ultrastructural characteristics, however, place the Blastocladiomycota as a sister clade to the Zygomycota, Glomeromycota, and Dikarya (Ascomycota and Basidiomycota). The blastocladiomycetes are saprotrophs, feeding on decomposing organic matter, and they are parasites of all eukaryotic groups. Unlike their close relatives, the chytrids, most of which exhibit zygotic meiosis, the blastocladiomycetes undergo sporic meiosis.

 

The Neocallimastigomycota were earlier placed in the phylum Chytridiomycota. Members of this small phylum are anaerobic organisms, living in the digestive system of larger herbivorous mammals and in other terrestrial and aquatic environments enriched in cellulose (e.g., domestic waste landfill sites). They lack mitochondria but contain hydrogenosomes of mitochondrial origin. As in the related chrytrids, neocallimastigomycetes form zoospores that are posteriorly uniflagellate or polyflagellate.

 

Microscopic view of a layer of translucent grayish cells, some containing small dark-color spheres

Arbuscular mycorrhiza seen under microscope. Flax root cortical cells containing paired arbuscules.

Cross-section of a cup-shaped structure showing locations of developing meiotic asci (upper edge of cup, left side, arrows pointing to two gray cells containing four and two small circles), sterile hyphae (upper edge of cup, right side, arrows pointing to white cells with a single small circle in them), and mature asci (upper edge of cup, pointing to two gray cells with eight small circles in them)

Diagram of an apothecium (the typical cup-like reproductive structure of Ascomycetes) showing sterile tissues as well as developing and mature asci.

Members of the Glomeromycota form arbuscular mycorrhizae, a form of mutualist symbiosis wherein fungal hyphae invade plant root cells and both species benefit from the resulting increased supply of nutrients. All known Glomeromycota species reproduce asexually. The symbiotic association between the Glomeromycota and plants is ancient, with evidence dating to 400 million years ago. Formerly part of the Zygomycota (commonly known as 'sugar' and 'pin' molds), the Glomeromycota were elevated to phylum status in 2001 and now replace the older phylum Zygomycota. Fungi that were placed in the Zygomycota are now being reassigned to the Glomeromycota, or the subphyla incertae sedis Mucoromycotina, Kickxellomycotina, the Zoopagomycotina and the Entomophthoromycotina. Some well-known examples of fungi formerly in the Zygomycota include black bread mold (Rhizopus stolonifer), and Pilobolus species, capable of ejecting spores several meters through the air. Medically relevant genera include Mucor, Rhizomucor, and Rhizopus.

 

The Ascomycota, commonly known as sac fungi or ascomycetes, constitute the largest taxonomic group within the Eumycota. These fungi form meiotic spores called ascospores, which are enclosed in a special sac-like structure called an ascus. This phylum includes morels, a few mushrooms and truffles, unicellular yeasts (e.g., of the genera Saccharomyces, Kluyveromyces, Pichia, and Candida), and many filamentous fungi living as saprotrophs, parasites, and mutualistic symbionts (e.g. lichens). Prominent and important genera of filamentous ascomycetes include Aspergillus, Penicillium, Fusarium, and Claviceps. Many ascomycete species have only been observed undergoing asexual reproduction (called anamorphic species), but analysis of molecular data has often been able to identify their closest teleomorphs in the Ascomycota. Because the products of meiosis are retained within the sac-like ascus, ascomycetes have been used for elucidating principles of genetics and heredity (e.g., Neurospora crassa).

 

Members of the Basidiomycota, commonly known as the club fungi or basidiomycetes, produce meiospores called basidiospores on club-like stalks called basidia. Most common mushrooms belong to this group, as well as rust and smut fungi, which are major pathogens of grains. Other important basidiomycetes include the maize pathogen Ustilago maydis, human commensal species of the genus Malassezia, and the opportunistic human pathogen, Cryptococcus neoformans.

 

Fungus-like organisms

Because of similarities in morphology and lifestyle, the slime molds (mycetozoans, plasmodiophorids, acrasids, Fonticula and labyrinthulids, now in Amoebozoa, Rhizaria, Excavata, Opisthokonta and Stramenopiles, respectively), water molds (oomycetes) and hyphochytrids (both Stramenopiles) were formerly classified in the kingdom Fungi, in groups like Mastigomycotina, Gymnomycota and Phycomycetes. The slime molds were studied also as protozoans, leading to an ambiregnal, duplicated taxonomy.

 

Unlike true fungi, the cell walls of oomycetes contain cellulose and lack chitin. Hyphochytrids have both chitin and cellulose. Slime molds lack a cell wall during the assimilative phase (except labyrinthulids, which have a wall of scales), and take in nutrients by ingestion (phagocytosis, except labyrinthulids) rather than absorption (osmotrophy, as fungi, labyrinthulids, oomycetes and hyphochytrids). Neither water molds nor slime molds are closely related to the true fungi, and, therefore, taxonomists no longer group them in the kingdom Fungi. Nonetheless, studies of the oomycetes and myxomycetes are still often included in mycology textbooks and primary research literature.

 

The Eccrinales and Amoebidiales are opisthokont protists, previously thought to be zygomycete fungi. Other groups now in Opisthokonta (e.g., Corallochytrium, Ichthyosporea) were also at given time classified as fungi. The genus Blastocystis, now in Stramenopiles, was originally classified as a yeast. Ellobiopsis, now in Alveolata, was considered a chytrid. The bacteria were also included in fungi in some classifications, as the group Schizomycetes.

 

The Rozellida clade, including the "ex-chytrid" Rozella, is a genetically disparate group known mostly from environmental DNA sequences that is a sister group to fungi. Members of the group that have been isolated lack the chitinous cell wall that is characteristic of fungi. Alternatively, Rozella can be classified as a basal fungal group.

 

The nucleariids may be the next sister group to the eumycete clade, and as such could be included in an expanded fungal kingdom. Many Actinomycetales (Actinomycetota), a group with many filamentous bacteria, were also long believed to be fungi.

 

Ecology

Although often inconspicuous, fungi occur in every environment on Earth and play very important roles in most ecosystems. Along with bacteria, fungi are the major decomposers in most terrestrial (and some aquatic) ecosystems, and therefore play a critical role in biogeochemical cycles and in many food webs. As decomposers, they play an essential role in nutrient cycling, especially as saprotrophs and symbionts, degrading organic matter to inorganic molecules, which can then re-enter anabolic metabolic pathways in plants or other organisms.

 

Symbiosis

Many fungi have important symbiotic relationships with organisms from most if not all kingdoms. These interactions can be mutualistic or antagonistic in nature, or in the case of commensal fungi are of no apparent benefit or detriment to the host.

 

With plants

Mycorrhizal symbiosis between plants and fungi is one of the most well-known plant–fungus associations and is of significant importance for plant growth and persistence in many ecosystems; over 90% of all plant species engage in mycorrhizal relationships with fungi and are dependent upon this relationship for survival.

 

A microscopic view of blue-stained cells, some with dark wavy lines in them

The dark filaments are hyphae of the endophytic fungus Epichloë coenophiala in the intercellular spaces of tall fescue leaf sheath tissue

The mycorrhizal symbiosis is ancient, dating back to at least 400 million years. It often increases the plant's uptake of inorganic compounds, such as nitrate and phosphate from soils having low concentrations of these key plant nutrients. The fungal partners may also mediate plant-to-plant transfer of carbohydrates and other nutrients. Such mycorrhizal communities are called "common mycorrhizal networks". A special case of mycorrhiza is myco-heterotrophy, whereby the plant parasitizes the fungus, obtaining all of its nutrients from its fungal symbiont. Some fungal species inhabit the tissues inside roots, stems, and leaves, in which case they are called endophytes. Similar to mycorrhiza, endophytic colonization by fungi may benefit both symbionts; for example, endophytes of grasses impart to their host increased resistance to herbivores and other environmental stresses and receive food and shelter from the plant in return.

 

With algae and cyanobacteria

A green, leaf-like structure attached to a tree, with a pattern of ridges and depression on the bottom surface

The lichen Lobaria pulmonaria, a symbiosis of fungal, algal, and cyanobacterial species

Lichens are a symbiotic relationship between fungi and photosynthetic algae or cyanobacteria. The photosynthetic partner in the relationship is referred to in lichen terminology as a "photobiont". The fungal part of the relationship is composed mostly of various species of ascomycetes and a few basidiomycetes. Lichens occur in every ecosystem on all continents, play a key role in soil formation and the initiation of biological succession, and are prominent in some extreme environments, including polar, alpine, and semiarid desert regions. They are able to grow on inhospitable surfaces, including bare soil, rocks, tree bark, wood, shells, barnacles and leaves. As in mycorrhizas, the photobiont provides sugars and other carbohydrates via photosynthesis to the fungus, while the fungus provides minerals and water to the photobiont. The functions of both symbiotic organisms are so closely intertwined that they function almost as a single organism; in most cases the resulting organism differs greatly from the individual components. Lichenization is a common mode of nutrition for fungi; around 27% of known fungi—more than 19,400 species—are lichenized. Characteristics common to most lichens include obtaining organic carbon by photosynthesis, slow growth, small size, long life, long-lasting (seasonal) vegetative reproductive structures, mineral nutrition obtained largely from airborne sources, and greater tolerance of desiccation than most other photosynthetic organisms in the same habitat.

 

With insects

Many insects also engage in mutualistic relationships with fungi. Several groups of ants cultivate fungi in the order Chaetothyriales for several purposes: as a food source, as a structural component of their nests, and as a part of an ant/plant symbiosis in the domatia (tiny chambers in plants that house arthropods). Ambrosia beetles cultivate various species of fungi in the bark of trees that they infest. Likewise, females of several wood wasp species (genus Sirex) inject their eggs together with spores of the wood-rotting fungus Amylostereum areolatum into the sapwood of pine trees; the growth of the fungus provides ideal nutritional conditions for the development of the wasp larvae. At least one species of stingless bee has a relationship with a fungus in the genus Monascus, where the larvae consume and depend on fungus transferred from old to new nests. Termites on the African savannah are also known to cultivate fungi, and yeasts of the genera Candida and Lachancea inhabit the gut of a wide range of insects, including neuropterans, beetles, and cockroaches; it is not known whether these fungi benefit their hosts. Fungi growing in dead wood are essential for xylophagous insects (e.g. woodboring beetles). They deliver nutrients needed by xylophages to nutritionally scarce dead wood. Thanks to this nutritional enrichment the larvae of the woodboring insect is able to grow and develop to adulthood. The larvae of many families of fungicolous flies, particularly those within the superfamily Sciaroidea such as the Mycetophilidae and some Keroplatidae feed on fungal fruiting bodies and sterile mycorrhizae.

 

A thin brown stick positioned horizontally with roughly two dozen clustered orange-red leaves originating from a single point in the middle of the stick. These orange leaves are three to four times larger than the few other green leaves growing out of the stick, and are covered on the lower leaf surface with hundreds of tiny bumps. The background shows the green leaves and branches of neighboring shrubs.

The plant pathogen Puccinia magellanicum (calafate rust) causes the defect known as witch's broom, seen here on a barberry shrub in Chile.

 

Gram stain of Candida albicans from a vaginal swab from a woman with candidiasis, showing hyphae, and chlamydospores, which are 2–4 µm in diameter.

Many fungi are parasites on plants, animals (including humans), and other fungi. Serious pathogens of many cultivated plants causing extensive damage and losses to agriculture and forestry include the rice blast fungus Magnaporthe oryzae, tree pathogens such as Ophiostoma ulmi and Ophiostoma novo-ulmi causing Dutch elm disease, Cryphonectria parasitica responsible for chestnut blight, and Phymatotrichopsis omnivora causing Texas Root Rot, and plant pathogens in the genera Fusarium, Ustilago, Alternaria, and Cochliobolus. Some carnivorous fungi, like Paecilomyces lilacinus, are predators of nematodes, which they capture using an array of specialized structures such as constricting rings or adhesive nets. Many fungi that are plant pathogens, such as Magnaporthe oryzae, can switch from being biotrophic (parasitic on living plants) to being necrotrophic (feeding on the dead tissues of plants they have killed). This same principle is applied to fungi-feeding parasites, including Asterotremella albida, which feeds on the fruit bodies of other fungi both while they are living and after they are dead.

 

Some fungi can cause serious diseases in humans, several of which may be fatal if untreated. These include aspergillosis, candidiasis, coccidioidomycosis, cryptococcosis, histoplasmosis, mycetomas, and paracoccidioidomycosis. Furthermore, persons with immuno-deficiencies are particularly susceptible to disease by genera such as Aspergillus, Candida, Cryptoccocus, Histoplasma, and Pneumocystis. Other fungi can attack eyes, nails, hair, and especially skin, the so-called dermatophytic and keratinophilic fungi, and cause local infections such as ringworm and athlete's foot. Fungal spores are also a cause of allergies, and fungi from different taxonomic groups can evoke allergic reactions.

 

As targets of mycoparasites

Organisms that parasitize fungi are known as mycoparasitic organisms. About 300 species of fungi and fungus-like organisms, belonging to 13 classes and 113 genera, are used as biocontrol agents against plant fungal diseases. Fungi can also act as mycoparasites or antagonists of other fungi, such as Hypomyces chrysospermus, which grows on bolete mushrooms. Fungi can also become the target of infection by mycoviruses.

 

Communication

Main article: Mycorrhizal networks

There appears to be electrical communication between fungi in word-like components according to spiking characteristics.

 

Possible impact on climate

According to a study published in the academic journal Current Biology, fungi can soak from the atmosphere around 36% of global fossil fuel greenhouse gas emissions.

 

Mycotoxins

(6aR,9R)-N-((2R,5S,10aS,10bS)-5-benzyl-10b-hydroxy-2-methyl-3,6-dioxooctahydro-2H-oxazolo[3,2-a] pyrrolo[2,1-c]pyrazin-2-yl)-7-methyl-4,6,6a,7,8,9-hexahydroindolo[4,3-fg] quinoline-9-carboxamide

Ergotamine, a major mycotoxin produced by Claviceps species, which if ingested can cause gangrene, convulsions, and hallucinations

Many fungi produce biologically active compounds, several of which are toxic to animals or plants and are therefore called mycotoxins. Of particular relevance to humans are mycotoxins produced by molds causing food spoilage, and poisonous mushrooms (see above). Particularly infamous are the lethal amatoxins in some Amanita mushrooms, and ergot alkaloids, which have a long history of causing serious epidemics of ergotism (St Anthony's Fire) in people consuming rye or related cereals contaminated with sclerotia of the ergot fungus, Claviceps purpurea. Other notable mycotoxins include the aflatoxins, which are insidious liver toxins and highly carcinogenic metabolites produced by certain Aspergillus species often growing in or on grains and nuts consumed by humans, ochratoxins, patulin, and trichothecenes (e.g., T-2 mycotoxin) and fumonisins, which have significant impact on human food supplies or animal livestock.

 

Mycotoxins are secondary metabolites (or natural products), and research has established the existence of biochemical pathways solely for the purpose of producing mycotoxins and other natural products in fungi. Mycotoxins may provide fitness benefits in terms of physiological adaptation, competition with other microbes and fungi, and protection from consumption (fungivory). Many fungal secondary metabolites (or derivatives) are used medically, as described under Human use below.

 

Pathogenic mechanisms

Ustilago maydis is a pathogenic plant fungus that causes smut disease in maize and teosinte. Plants have evolved efficient defense systems against pathogenic microbes such as U. maydis. A rapid defense reaction after pathogen attack is the oxidative burst where the plant produces reactive oxygen species at the site of the attempted invasion. U. maydis can respond to the oxidative burst with an oxidative stress response, regulated by the gene YAP1. The response protects U. maydis from the host defense, and is necessary for the pathogen's virulence. Furthermore, U. maydis has a well-established recombinational DNA repair system which acts during mitosis and meiosis. The system may assist the pathogen in surviving DNA damage arising from the host plant's oxidative defensive response to infection.

 

Cryptococcus neoformans is an encapsulated yeast that can live in both plants and animals. C. neoformans usually infects the lungs, where it is phagocytosed by alveolar macrophages. Some C. neoformans can survive inside macrophages, which appears to be the basis for latency, disseminated disease, and resistance to antifungal agents. One mechanism by which C. neoformans survives the hostile macrophage environment is by up-regulating the expression of genes involved in the oxidative stress response. Another mechanism involves meiosis. The majority of C. neoformans are mating "type a". Filaments of mating "type a" ordinarily have haploid nuclei, but they can become diploid (perhaps by endoduplication or by stimulated nuclear fusion) to form blastospores. The diploid nuclei of blastospores can undergo meiosis, including recombination, to form haploid basidiospores that can be dispersed. This process is referred to as monokaryotic fruiting. This process requires a gene called DMC1, which is a conserved homologue of genes recA in bacteria and RAD51 in eukaryotes, that mediates homologous chromosome pairing during meiosis and repair of DNA double-strand breaks. Thus, C. neoformans can undergo a meiosis, monokaryotic fruiting, that promotes recombinational repair in the oxidative, DNA damaging environment of the host macrophage, and the repair capability may contribute to its virulence.

 

Human use

See also: Human interactions with fungi

Microscopic view of five spherical structures; one of the spheres is considerably smaller than the rest and attached to one of the larger spheres

Saccharomyces cerevisiae cells shown with DIC microscopy

The human use of fungi for food preparation or preservation and other purposes is extensive and has a long history. Mushroom farming and mushroom gathering are large industries in many countries. The study of the historical uses and sociological impact of fungi is known as ethnomycology. Because of the capacity of this group to produce an enormous range of natural products with antimicrobial or other biological activities, many species have long been used or are being developed for industrial production of antibiotics, vitamins, and anti-cancer and cholesterol-lowering drugs. Methods have been developed for genetic engineering of fungi, enabling metabolic engineering of fungal species. For example, genetic modification of yeast species—which are easy to grow at fast rates in large fermentation vessels—has opened up ways of pharmaceutical production that are potentially more efficient than production by the original source organisms. Fungi-based industries are sometimes considered to be a major part of a growing bioeconomy, with applications under research and development including use for textiles, meat substitution and general fungal biotechnology.

 

Therapeutic uses

Modern chemotherapeutics

Many species produce metabolites that are major sources of pharmacologically active drugs.

 

Antibiotics

Particularly important are the antibiotics, including the penicillins, a structurally related group of β-lactam antibiotics that are synthesized from small peptides. Although naturally occurring penicillins such as penicillin G (produced by Penicillium chrysogenum) have a relatively narrow spectrum of biological activity, a wide range of other penicillins can be produced by chemical modification of the natural penicillins. Modern penicillins are semisynthetic compounds, obtained initially from fermentation cultures, but then structurally altered for specific desirable properties. Other antibiotics produced by fungi include: ciclosporin, commonly used as an immunosuppressant during transplant surgery; and fusidic acid, used to help control infection from methicillin-resistant Staphylococcus aureus bacteria. Widespread use of antibiotics for the treatment of bacterial diseases, such as tuberculosis, syphilis, leprosy, and others began in the early 20th century and continues to date. In nature, antibiotics of fungal or bacterial origin appear to play a dual role: at high concentrations they act as chemical defense against competition with other microorganisms in species-rich environments, such as the rhizosphere, and at low concentrations as quorum-sensing molecules for intra- or interspecies signaling.

 

Other

Other drugs produced by fungi include griseofulvin isolated from Penicillium griseofulvum, used to treat fungal infections, and statins (HMG-CoA reductase inhibitors), used to inhibit cholesterol synthesis. Examples of statins found in fungi include mevastatin from Penicillium citrinum and lovastatin from Aspergillus terreus and the oyster mushroom. Psilocybin from fungi is investigated for therapeutic use and appears to cause global increases in brain network integration. Fungi produce compounds that inhibit viruses and cancer cells. Specific metabolites, such as polysaccharide-K, ergotamine, and β-lactam antibiotics, are routinely used in clinical medicine. The shiitake mushroom is a source of lentinan, a clinical drug approved for use in cancer treatments in several countries, including Japan. In Europe and Japan, polysaccharide-K (brand name Krestin), a chemical derived from Trametes versicolor, is an approved adjuvant for cancer therapy.

 

Traditional medicine

Upper surface view of a kidney-shaped fungus, brownish-red with a lighter yellow-brown margin, and a somewhat varnished or shiny appearance

Two dried yellow-orange caterpillars, one with a curly grayish fungus growing out of one of its ends. The grayish fungus is roughly equal to or slightly greater in length than the caterpillar, and tapers in thickness to a narrow end.

The fungi Ganoderma lucidum (left) and Ophiocordyceps sinensis (right) are used in traditional medicine practices

Certain mushrooms are used as supposed therapeutics in folk medicine practices, such as traditional Chinese medicine. Mushrooms with a history of such use include Agaricus subrufescens, Ganoderma lucidum, and Ophiocordyceps sinensis.

 

Cultured foods

Baker's yeast or Saccharomyces cerevisiae, a unicellular fungus, is used to make bread and other wheat-based products, such as pizza dough and dumplings. Yeast species of the genus Saccharomyces are also used to produce alcoholic beverages through fermentation. Shoyu koji mold (Aspergillus oryzae) is an essential ingredient in brewing Shoyu (soy sauce) and sake, and the preparation of miso while Rhizopus species are used for making tempeh. Several of these fungi are domesticated species that were bred or selected according to their capacity to ferment food without producing harmful mycotoxins (see below), which are produced by very closely related Aspergilli. Quorn, a meat substitute, is made from Fusarium venenatum.

2021/3/13~3/14

大直美麗華

TiL Vol.5

 

Mitochondria粒線體偶像學院

www.facebook.com/MitochondriaIC

 

#29橘央檸

www.instagram.com/mitochondria_younei29/

 

#36KIRA

www.instagram.com/kira173_36/

 

#46婉豆

www.instagram.com/onedoumame_46/

 

#50慕斯

www.instagram.com/musu_50/

 

#53菜菜

www.instagram.com/veg_53/

 

#65YUUNA (本次活動未登場)

www.instagram.com/yuunana_65/

 

#74MARU

www.instagram.com/maruuuuu_74/

Image by Kira Heikes. Hypsibius exemplaris embryo. For imaging method, see the McGreevy et al 2018 protocol here: cshprotocols.cshlp.org/content/2018/11.toc

Mitochondria stained.

2021/3/13~3/14

大直美麗華

TiL Vol.5

 

Mitochondria粒線體偶像學院

www.facebook.com/MitochondriaIC

 

#29橘央檸

www.instagram.com/mitochondria_younei29/

 

#36KIRA

www.instagram.com/kira173_36/

 

#46婉豆

www.instagram.com/onedoumame_46/

 

#50慕斯

www.instagram.com/musu_50/

 

#53菜菜

www.instagram.com/veg_53/

 

#65YUUNA (本次活動未登場)

www.instagram.com/yuunana_65/

 

#74MARU

www.instagram.com/maruuuuu_74/

The cells shown here are fibroblasts, one of the most common cells in mammalian connective tissue. These particular cells were taken from a mouse. DNA within the nucleus (blue), mitochondria (green), and cellular skeleton (red) are clearly visible. This image was featured in an exhibit called Life: Magnified from June 3, 2014, to January 21, 2015, at Washington Dulles International Airport's Gateway Gallery. Credit: D. Burnette and J. Lippincott-Schwartz, NICHD

Marked or stamped in stainless steel: Mirro, alluding to the mirrors of memory, the many ways in which time might be dialed, measured or watched, but still inexorably unwind. Joan Miró, growing up in the radial streets and gaudy plazas of Barcelona, running through the dappled patches of heat and shade in the Barri Gòtic from the Rambla to blue vistas of the Mediterranean and the sudden smell of fish and brine, would measure these ideas with blue glass beads, the size of seeds, which he kept in the pockets of his herringbone jacket, and return to the shop his father owned, through the chimes and cuckoo tones and descending weights of the front, to the cluttered wooden workroom in the back, where his father would sit squinting through monocular glasses of various powers, opening the plated cases of wristwatches and clocks, holding the circular movements to the light, rubricated bearings shining like fire, and coilsprings breathing, as if alive. Look, a tourbillon, invented in 1795 by Abraham-Louis Breguet, spinning about a tiny cage of

its own, to counteract the ravages of gravity and weight....you see the escapement there? And here, look, the balance wheel...no, you mustn’t touch...very fragile... this is a bimetallic wheel designed to compensate for changes in the temperature, even metal reacts to world around...it does the very same thing as a pendulum, that is to say, it pulses or oscillates like this...(Miró’s father rhythmically tapped the coarse grain of the workbench with the four fingers of his left hand)...you see? The isochronous motion of pendulums were first noticed by Galileo after 1602, and the pendulum, as an horological device, was invented by Christian Huygens in 1656.

 

But the spring escapement itself was devised by Robert Hooke...now look, we’ll close this particular watch like this. Growing up in the Barcelona, Joan Miró knew that the British natural philosopher Robert Hooke had also graphically captured the cells of sliced cork in his Micrographia, and knew that he was composed of similar cells, similarly eukaryotic, although without the cell walls or chloroplasts of plants; his components could engage in mitosis and contained nuclei, mitochondria, Golgi apparatus, and varied accordingly to make him who he was, although he did not yet know how. At some scale, though, the distinction between the components that might properly be called organic and those that weren’t became quite indistinct....he had read of atoms in Catalonian Science at the round corner news & serial stand... a cloud of electrons, negatively charged, surrounding a nucleus smaller than a single angstrom or capital A marked with a disc of degree. Years later, in the Montparnasse, Miró mentioned these memories at a dinner party with a

menu that would eventually inspire the films of Louis Bu?uel. Henri Lautreamont had returned from the library with a tray of faceted glasses and a bottle of Glen St. Kilda unfiltered Scotch whiskey, which everyone soon agreed was the highlight of the party, and much better than the mock-lobster soufflés that Salvador Dalí had made especially for the affair.

 

Hence we find that G. has alluded to the clockwork biology of Joan Miró, the translations of Hugh Evelyn-White of the Shield of Herakles ascribed to Hesiod, and the precedent passages in the Iliad 18. 478-608, where the ekphrasis of the shield can be viewed as a microcosm of the earth: the microcosm of modern existence is uniform, banal, either reflective or brushed, recursive, marked with gradients on the invisible far side, and doomed to unwind. But it has been modified by individual experience regardless. The spiral-bound notebook that G. purchased on a rainy day at a Woolworth’s on Broadway evinces that he planned to develop the photograph of the two robins to the left, each a type of North American Thrush, into an extended meditation on their tiny biotopes defended by an acquired and sophisticated song, woven from discrete elements, repeated and rearranged, rather like the oral hexameters of the Iliad were first arranged from a discrete cluster of phrases embedded in memory, and shaped by song. During the course of his research, Albert Bates Lord had not only noticed parallels between the Homeric epics and Bosnian oral tradition, but had traveled to the outer Hebrides collecting recordings of Gaelic

songs; one of his destinations had been a gray and mossy cluster of stone cottages huddled around a red brick distillery in the archipelago of St. Kilda, in the cold seas

sixty-four kilometers north of North Uist, the outermost Hebrides, the epicenter of nowhere, the end of the world.

 

The photograph to the right is an image of the Glen St. Kilda distillery on the island of Hirta, but the last known image of the distillery remains in the visual reference files owned by the estate of the famed Belgian cartoonist Yves Bucquoy, better known by the nom de plume Spirou, creator of Knip Swaarte. When Scotland Yard closed the Fabbri case in 1932, the collected photographs of Kaspar Linz, the Austrian photographer and detective assigned to Lautreamont for decades, were consigned to a suitcase and left in an alley, together with several speed-graphics backs and several unused bottles of emulsion. They were accidentally discovered by a Belgian ephemera dealer, who had arrived in Paris in search of siege-era magazines (Le Père Duchesne was a favorite) and contemporary menus featuring carefully prepared zoo animals from Voisin’s. He had become drunk on an unfamiliar brand of absinthe, and had wandered into the alley attempting his best impression of an Arnaut Daniel poem in improvised Occitan, before he passed out on the suitcase, a mound of wilted cabbage mixed with sawdust, and two empty bottles of champagne.

 

In the gray light of a cloudy morning, he awoke to a sepia image of a man engaged in the act of painting, blurred from motion, out of focus, through a window, but compelling nonetheless. He transported the entire case back to Brussels and tried to sell the photographs as a lot, within the battered morocco case with its festoon of pasted railway stickers, as evidence from a forgotten mystery. His ephemera store became insolvent after he died in 1937, and its contents (deemed worthless by the property owners) were consigned to the curb, where they were discovered by Spirou, who had been thinking of increasing the realism of his Knip series through carefully adapted visual files. One of the photographs depicted the label on a wooden crate that had once held twelve bottles of single malt, unfiltered Glen St. Kilda whiskey: a brick smokestack for peat fires, a small brick bulding, copied from an engraving that had been commissioned in 1897 by the distillery owners, the descendants and heirs of Prince Charles Edward Stuart (or so they

believed), when the island was at the height of its fortunes (which were never that fortunate at all). When barrels of the whiskey were complete, a bonfire would be lighted on the peak of Conchair, and a ship would depart from the village at Beneray, after being noticed by the lighthouse keeper. Always highly prized, the whiskey would be lost forever when the inhabitants of the island were swept away by a squall on Midsummer night, when they were participating in the traditional cliffside stilt-walking contest practiced throughout the Hebrides.

 

After several months of research, Spirou made the remote and gannet-haunted island the setting for a Knip Adventure, containing mysterious flights by VS-300 helicopters (which were still in development by Vought-Sikorsky when Spirou began drawing his book) over Plymouth Sound in Devon, England, and Midsummer festivals on the island of Hirta. G. had lost the book in Chicago, years ago, and reprints were almost impossible to find. Still, he painted a memory that had been submerged for decades, one which had survived through a dozen permutations, and remained.

 

This painting is a copy of the original, painted in 2005. Oil on canvas, 9 x 12 in (22.9 x 30.5 cm). Collection of the artist.

It's somewhere between toxic and extremely toxic depending on which source you read. The fruit is said to have an intensely sweet, saccharine-like initial taste, followed by a bitter aftertaste. In low doses it causes nausea and a reversible delirium. In higher doses it depolarizes your mitochondria and kills you.

 

The fruits are about a centimeter in length. They look like tiny plum tomatoes, and in fact both plants are in the same genus (Solanum). Though it's a lovely plant, it has to be banished given that it's growing where the dogs can get to it.

 

Bittersweet Nightshade was introduced from Europe as a medicinal herb, but it's now broadly naturalized. We found this one growing on a fence in a tangle of Multiflora Rose, Bladder Campion and Ground Ivy, all of which are introduced plants.

 

Our farm is the Museum of Invasive Species.

 

Solanum dulcamara.

Created with fd's Flickr Toys.

A fungus (pl.: fungi or funguses) is any member of the group of eukaryotic organisms that includes microorganisms such as yeasts and molds, as well as the more familiar mushrooms. These organisms are classified as one of the traditional eukaryotic kingdoms, along with Animalia, Plantae and either Protista or Protozoa and Chromista.

 

A characteristic that places fungi in a different kingdom from plants, bacteria, and some protists is chitin in their cell walls. Fungi, like animals, are heterotrophs; they acquire their food by absorbing dissolved molecules, typically by secreting digestive enzymes into their environment. Fungi do not photosynthesize. Growth is their means of mobility, except for spores (a few of which are flagellated), which may travel through the air or water. Fungi are the principal decomposers in ecological systems. These and other differences place fungi in a single group of related organisms, named the Eumycota (true fungi or Eumycetes), that share a common ancestor (i.e. they form a monophyletic group), an interpretation that is also strongly supported by molecular phylogenetics. This fungal group is distinct from the structurally similar myxomycetes (slime molds) and oomycetes (water molds). The discipline of biology devoted to the study of fungi is known as mycology (from the Greek μύκης mykes, mushroom). In the past mycology was regarded as a branch of botany, although it is now known that fungi are genetically more closely related to animals than to plants.

 

Abundant worldwide, most fungi are inconspicuous because of the small size of their structures, and their cryptic lifestyles in soil or on dead matter. Fungi include symbionts of plants, animals, or other fungi and also parasites. They may become noticeable when fruiting, either as mushrooms or as molds. Fungi perform an essential role in the decomposition of organic matter and have fundamental roles in nutrient cycling and exchange in the environment. They have long been used as a direct source of human food, in the form of mushrooms and truffles; as a leavening agent for bread; and in the fermentation of various food products, such as wine, beer, and soy sauce. Since the 1940s, fungi have been used for the production of antibiotics, and, more recently, various enzymes produced by fungi are used industrially and in detergents. Fungi are also used as biological pesticides to control weeds, plant diseases, and insect pests. Many species produce bioactive compounds called mycotoxins, such as alkaloids and polyketides, that are toxic to animals, including humans. The fruiting structures of a few species contain psychotropic compounds and are consumed recreationally or in traditional spiritual ceremonies. Fungi can break down manufactured materials and buildings, and become significant pathogens of humans and other animals. Losses of crops due to fungal diseases (e.g., rice blast disease) or food spoilage can have a large impact on human food supplies and local economies.

 

The fungus kingdom encompasses an enormous diversity of taxa with varied ecologies, life cycle strategies, and morphologies ranging from unicellular aquatic chytrids to large mushrooms. However, little is known of the true biodiversity of the fungus kingdom, which has been estimated at 2.2 million to 3.8 million species. Of these, only about 148,000 have been described, with over 8,000 species known to be detrimental to plants and at least 300 that can be pathogenic to humans. Ever since the pioneering 18th and 19th century taxonomical works of Carl Linnaeus, Christiaan Hendrik Persoon, and Elias Magnus Fries, fungi have been classified according to their morphology (e.g., characteristics such as spore color or microscopic features) or physiology. Advances in molecular genetics have opened the way for DNA analysis to be incorporated into taxonomy, which has sometimes challenged the historical groupings based on morphology and other traits. Phylogenetic studies published in the first decade of the 21st century have helped reshape the classification within the fungi kingdom, which is divided into one subkingdom, seven phyla, and ten subphyla.

 

Etymology

The English word fungus is directly adopted from the Latin fungus (mushroom), used in the writings of Horace and Pliny. This in turn is derived from the Greek word sphongos (σφόγγος 'sponge'), which refers to the macroscopic structures and morphology of mushrooms and molds; the root is also used in other languages, such as the German Schwamm ('sponge') and Schimmel ('mold').

 

The word mycology is derived from the Greek mykes (μύκης 'mushroom') and logos (λόγος 'discourse'). It denotes the scientific study of fungi. The Latin adjectival form of "mycology" (mycologicæ) appeared as early as 1796 in a book on the subject by Christiaan Hendrik Persoon. The word appeared in English as early as 1824 in a book by Robert Kaye Greville. In 1836 the English naturalist Miles Joseph Berkeley's publication The English Flora of Sir James Edward Smith, Vol. 5. also refers to mycology as the study of fungi.

 

A group of all the fungi present in a particular region is known as mycobiota (plural noun, no singular). The term mycota is often used for this purpose, but many authors use it as a synonym of Fungi. The word funga has been proposed as a less ambiguous term morphologically similar to fauna and flora. The Species Survival Commission (SSC) of the International Union for Conservation of Nature (IUCN) in August 2021 asked that the phrase fauna and flora be replaced by fauna, flora, and funga.

 

Characteristics

 

Fungal hyphae cells

Hyphal wall

Septum

Mitochondrion

Vacuole

Ergosterol crystal

Ribosome

Nucleus

Endoplasmic reticulum

Lipid body

Plasma membrane

Spitzenkörper

Golgi apparatus

 

Fungal cell cycle showing Dikaryons typical of Higher Fungi

Before the introduction of molecular methods for phylogenetic analysis, taxonomists considered fungi to be members of the plant kingdom because of similarities in lifestyle: both fungi and plants are mainly immobile, and have similarities in general morphology and growth habitat. Although inaccurate, the common misconception that fungi are plants persists among the general public due to their historical classification, as well as several similarities. Like plants, fungi often grow in soil and, in the case of mushrooms, form conspicuous fruit bodies, which sometimes resemble plants such as mosses. The fungi are now considered a separate kingdom, distinct from both plants and animals, from which they appear to have diverged around one billion years ago (around the start of the Neoproterozoic Era). Some morphological, biochemical, and genetic features are shared with other organisms, while others are unique to the fungi, clearly separating them from the other kingdoms:

 

With other eukaryotes: Fungal cells contain membrane-bound nuclei with chromosomes that contain DNA with noncoding regions called introns and coding regions called exons. Fungi have membrane-bound cytoplasmic organelles such as mitochondria, sterol-containing membranes, and ribosomes of the 80S type. They have a characteristic range of soluble carbohydrates and storage compounds, including sugar alcohols (e.g., mannitol), disaccharides, (e.g., trehalose), and polysaccharides (e.g., glycogen, which is also found in animals).

With animals: Fungi lack chloroplasts and are heterotrophic organisms and so require preformed organic compounds as energy sources.

With plants: Fungi have a cell wall and vacuoles. They reproduce by both sexual and asexual means, and like basal plant groups (such as ferns and mosses) produce spores. Similar to mosses and algae, fungi typically have haploid nuclei.

With euglenoids and bacteria: Higher fungi, euglenoids, and some bacteria produce the amino acid L-lysine in specific biosynthesis steps, called the α-aminoadipate pathway.

The cells of most fungi grow as tubular, elongated, and thread-like (filamentous) structures called hyphae, which may contain multiple nuclei and extend by growing at their tips. Each tip contains a set of aggregated vesicles—cellular structures consisting of proteins, lipids, and other organic molecules—called the Spitzenkörper. Both fungi and oomycetes grow as filamentous hyphal cells. In contrast, similar-looking organisms, such as filamentous green algae, grow by repeated cell division within a chain of cells. There are also single-celled fungi (yeasts) that do not form hyphae, and some fungi have both hyphal and yeast forms.

In common with some plant and animal species, more than one hundred fungal species display bioluminescence.

Unique features:

 

Some species grow as unicellular yeasts that reproduce by budding or fission. Dimorphic fungi can switch between a yeast phase and a hyphal phase in response to environmental conditions.

The fungal cell wall is made of a chitin-glucan complex; while glucans are also found in plants and chitin in the exoskeleton of arthropods, fungi are the only organisms that combine these two structural molecules in their cell wall. Unlike those of plants and oomycetes, fungal cell walls do not contain cellulose.

A whitish fan or funnel-shaped mushroom growing at the base of a tree.

Omphalotus nidiformis, a bioluminescent mushroom

Most fungi lack an efficient system for the long-distance transport of water and nutrients, such as the xylem and phloem in many plants. To overcome this limitation, some fungi, such as Armillaria, form rhizomorphs, which resemble and perform functions similar to the roots of plants. As eukaryotes, fungi possess a biosynthetic pathway for producing terpenes that uses mevalonic acid and pyrophosphate as chemical building blocks. Plants and some other organisms have an additional terpene biosynthesis pathway in their chloroplasts, a structure that fungi and animals do not have. Fungi produce several secondary metabolites that are similar or identical in structure to those made by plants. Many of the plant and fungal enzymes that make these compounds differ from each other in sequence and other characteristics, which indicates separate origins and convergent evolution of these enzymes in the fungi and plants.

 

Diversity

Fungi have a worldwide distribution, and grow in a wide range of habitats, including extreme environments such as deserts or areas with high salt concentrations or ionizing radiation, as well as in deep sea sediments. Some can survive the intense UV and cosmic radiation encountered during space travel. Most grow in terrestrial environments, though several species live partly or solely in aquatic habitats, such as the chytrid fungi Batrachochytrium dendrobatidis and B. salamandrivorans, parasites that have been responsible for a worldwide decline in amphibian populations. These organisms spend part of their life cycle as a motile zoospore, enabling them to propel itself through water and enter their amphibian host. Other examples of aquatic fungi include those living in hydrothermal areas of the ocean.

 

As of 2020, around 148,000 species of fungi have been described by taxonomists, but the global biodiversity of the fungus kingdom is not fully understood. A 2017 estimate suggests there may be between 2.2 and 3.8 million species The number of new fungi species discovered yearly has increased from 1,000 to 1,500 per year about 10 years ago, to about 2000 with a peak of more than 2,500 species in 2016. In the year 2019, 1882 new species of fungi were described, and it was estimated that more than 90% of fungi remain unknown The following year, 2905 new species were described—the highest annual record of new fungus names. In mycology, species have historically been distinguished by a variety of methods and concepts. Classification based on morphological characteristics, such as the size and shape of spores or fruiting structures, has traditionally dominated fungal taxonomy. Species may also be distinguished by their biochemical and physiological characteristics, such as their ability to metabolize certain biochemicals, or their reaction to chemical tests. The biological species concept discriminates species based on their ability to mate. The application of molecular tools, such as DNA sequencing and phylogenetic analysis, to study diversity has greatly enhanced the resolution and added robustness to estimates of genetic diversity within various taxonomic groups.

 

Mycology

Mycology is the branch of biology concerned with the systematic study of fungi, including their genetic and biochemical properties, their taxonomy, and their use to humans as a source of medicine, food, and psychotropic substances consumed for religious purposes, as well as their dangers, such as poisoning or infection. The field of phytopathology, the study of plant diseases, is closely related because many plant pathogens are fungi.

 

The use of fungi by humans dates back to prehistory; Ötzi the Iceman, a well-preserved mummy of a 5,300-year-old Neolithic man found frozen in the Austrian Alps, carried two species of polypore mushrooms that may have been used as tinder (Fomes fomentarius), or for medicinal purposes (Piptoporus betulinus). Ancient peoples have used fungi as food sources—often unknowingly—for millennia, in the preparation of leavened bread and fermented juices. Some of the oldest written records contain references to the destruction of crops that were probably caused by pathogenic fungi.

 

History

Mycology became a systematic science after the development of the microscope in the 17th century. Although fungal spores were first observed by Giambattista della Porta in 1588, the seminal work in the development of mycology is considered to be the publication of Pier Antonio Micheli's 1729 work Nova plantarum genera. Micheli not only observed spores but also showed that, under the proper conditions, they could be induced into growing into the same species of fungi from which they originated. Extending the use of the binomial system of nomenclature introduced by Carl Linnaeus in his Species plantarum (1753), the Dutch Christiaan Hendrik Persoon (1761–1836) established the first classification of mushrooms with such skill as to be considered a founder of modern mycology. Later, Elias Magnus Fries (1794–1878) further elaborated the classification of fungi, using spore color and microscopic characteristics, methods still used by taxonomists today. Other notable early contributors to mycology in the 17th–19th and early 20th centuries include Miles Joseph Berkeley, August Carl Joseph Corda, Anton de Bary, the brothers Louis René and Charles Tulasne, Arthur H. R. Buller, Curtis G. Lloyd, and Pier Andrea Saccardo. In the 20th and 21st centuries, advances in biochemistry, genetics, molecular biology, biotechnology, DNA sequencing and phylogenetic analysis has provided new insights into fungal relationships and biodiversity, and has challenged traditional morphology-based groupings in fungal taxonomy.

 

Morphology

Microscopic structures

Monochrome micrograph showing Penicillium hyphae as long, transparent, tube-like structures a few micrometres across. Conidiophores branch out laterally from the hyphae, terminating in bundles of phialides on which spherical condidiophores are arranged like beads on a string. Septa are faintly visible as dark lines crossing the hyphae.

An environmental isolate of Penicillium

Hypha

Conidiophore

Phialide

Conidia

Septa

Most fungi grow as hyphae, which are cylindrical, thread-like structures 2–10 µm in diameter and up to several centimeters in length. Hyphae grow at their tips (apices); new hyphae are typically formed by emergence of new tips along existing hyphae by a process called branching, or occasionally growing hyphal tips fork, giving rise to two parallel-growing hyphae. Hyphae also sometimes fuse when they come into contact, a process called hyphal fusion (or anastomosis). These growth processes lead to the development of a mycelium, an interconnected network of hyphae. Hyphae can be either septate or coenocytic. Septate hyphae are divided into compartments separated by cross walls (internal cell walls, called septa, that are formed at right angles to the cell wall giving the hypha its shape), with each compartment containing one or more nuclei; coenocytic hyphae are not compartmentalized. Septa have pores that allow cytoplasm, organelles, and sometimes nuclei to pass through; an example is the dolipore septum in fungi of the phylum Basidiomycota. Coenocytic hyphae are in essence multinucleate supercells.

 

Many species have developed specialized hyphal structures for nutrient uptake from living hosts; examples include haustoria in plant-parasitic species of most fungal phyla,[63] and arbuscules of several mycorrhizal fungi, which penetrate into the host cells to consume nutrients.

 

Although fungi are opisthokonts—a grouping of evolutionarily related organisms broadly characterized by a single posterior flagellum—all phyla except for the chytrids have lost their posterior flagella. Fungi are unusual among the eukaryotes in having a cell wall that, in addition to glucans (e.g., β-1,3-glucan) and other typical components, also contains the biopolymer chitin.

 

Macroscopic structures

Fungal mycelia can become visible to the naked eye, for example, on various surfaces and substrates, such as damp walls and spoiled food, where they are commonly called molds. Mycelia grown on solid agar media in laboratory petri dishes are usually referred to as colonies. These colonies can exhibit growth shapes and colors (due to spores or pigmentation) that can be used as diagnostic features in the identification of species or groups. Some individual fungal colonies can reach extraordinary dimensions and ages as in the case of a clonal colony of Armillaria solidipes, which extends over an area of more than 900 ha (3.5 square miles), with an estimated age of nearly 9,000 years.

 

The apothecium—a specialized structure important in sexual reproduction in the ascomycetes—is a cup-shaped fruit body that is often macroscopic and holds the hymenium, a layer of tissue containing the spore-bearing cells. The fruit bodies of the basidiomycetes (basidiocarps) and some ascomycetes can sometimes grow very large, and many are well known as mushrooms.

 

Growth and physiology

Time-lapse photography sequence of a peach becoming progressively discolored and disfigured

Mold growth covering a decaying peach. The frames were taken approximately 12 hours apart over a period of six days.

The growth of fungi as hyphae on or in solid substrates or as single cells in aquatic environments is adapted for the efficient extraction of nutrients, because these growth forms have high surface area to volume ratios. Hyphae are specifically adapted for growth on solid surfaces, and to invade substrates and tissues. They can exert large penetrative mechanical forces; for example, many plant pathogens, including Magnaporthe grisea, form a structure called an appressorium that evolved to puncture plant tissues.[71] The pressure generated by the appressorium, directed against the plant epidermis, can exceed 8 megapascals (1,200 psi).[71] The filamentous fungus Paecilomyces lilacinus uses a similar structure to penetrate the eggs of nematodes.

 

The mechanical pressure exerted by the appressorium is generated from physiological processes that increase intracellular turgor by producing osmolytes such as glycerol. Adaptations such as these are complemented by hydrolytic enzymes secreted into the environment to digest large organic molecules—such as polysaccharides, proteins, and lipids—into smaller molecules that may then be absorbed as nutrients. The vast majority of filamentous fungi grow in a polar fashion (extending in one direction) by elongation at the tip (apex) of the hypha. Other forms of fungal growth include intercalary extension (longitudinal expansion of hyphal compartments that are below the apex) as in the case of some endophytic fungi, or growth by volume expansion during the development of mushroom stipes and other large organs. Growth of fungi as multicellular structures consisting of somatic and reproductive cells—a feature independently evolved in animals and plants—has several functions, including the development of fruit bodies for dissemination of sexual spores (see above) and biofilms for substrate colonization and intercellular communication.

 

Fungi are traditionally considered heterotrophs, organisms that rely solely on carbon fixed by other organisms for metabolism. Fungi have evolved a high degree of metabolic versatility that allows them to use a diverse range of organic substrates for growth, including simple compounds such as nitrate, ammonia, acetate, or ethanol. In some species the pigment melanin may play a role in extracting energy from ionizing radiation, such as gamma radiation. This form of "radiotrophic" growth has been described for only a few species, the effects on growth rates are small, and the underlying biophysical and biochemical processes are not well known. This process might bear similarity to CO2 fixation via visible light, but instead uses ionizing radiation as a source of energy.

 

Reproduction

Two thickly stemmed brownish mushrooms with scales on the upper surface, growing out of a tree trunk

Polyporus squamosus

Fungal reproduction is complex, reflecting the differences in lifestyles and genetic makeup within this diverse kingdom of organisms. It is estimated that a third of all fungi reproduce using more than one method of propagation; for example, reproduction may occur in two well-differentiated stages within the life cycle of a species, the teleomorph (sexual reproduction) and the anamorph (asexual reproduction). Environmental conditions trigger genetically determined developmental states that lead to the creation of specialized structures for sexual or asexual reproduction. These structures aid reproduction by efficiently dispersing spores or spore-containing propagules.

 

Asexual reproduction

Asexual reproduction occurs via vegetative spores (conidia) or through mycelial fragmentation. Mycelial fragmentation occurs when a fungal mycelium separates into pieces, and each component grows into a separate mycelium. Mycelial fragmentation and vegetative spores maintain clonal populations adapted to a specific niche, and allow more rapid dispersal than sexual reproduction. The "Fungi imperfecti" (fungi lacking the perfect or sexual stage) or Deuteromycota comprise all the species that lack an observable sexual cycle. Deuteromycota (alternatively known as Deuteromycetes, conidial fungi, or mitosporic fungi) is not an accepted taxonomic clade and is now taken to mean simply fungi that lack a known sexual stage.

 

Sexual reproduction

See also: Mating in fungi and Sexual selection in fungi

Sexual reproduction with meiosis has been directly observed in all fungal phyla except Glomeromycota (genetic analysis suggests meiosis in Glomeromycota as well). It differs in many aspects from sexual reproduction in animals or plants. Differences also exist between fungal groups and can be used to discriminate species by morphological differences in sexual structures and reproductive strategies. Mating experiments between fungal isolates may identify species on the basis of biological species concepts. The major fungal groupings have initially been delineated based on the morphology of their sexual structures and spores; for example, the spore-containing structures, asci and basidia, can be used in the identification of ascomycetes and basidiomycetes, respectively. Fungi employ two mating systems: heterothallic species allow mating only between individuals of the opposite mating type, whereas homothallic species can mate, and sexually reproduce, with any other individual or itself.

 

Most fungi have both a haploid and a diploid stage in their life cycles. In sexually reproducing fungi, compatible individuals may combine by fusing their hyphae together into an interconnected network; this process, anastomosis, is required for the initiation of the sexual cycle. Many ascomycetes and basidiomycetes go through a dikaryotic stage, in which the nuclei inherited from the two parents do not combine immediately after cell fusion, but remain separate in the hyphal cells (see heterokaryosis).

 

In ascomycetes, dikaryotic hyphae of the hymenium (the spore-bearing tissue layer) form a characteristic hook (crozier) at the hyphal septum. During cell division, the formation of the hook ensures proper distribution of the newly divided nuclei into the apical and basal hyphal compartments. An ascus (plural asci) is then formed, in which karyogamy (nuclear fusion) occurs. Asci are embedded in an ascocarp, or fruiting body. Karyogamy in the asci is followed immediately by meiosis and the production of ascospores. After dispersal, the ascospores may germinate and form a new haploid mycelium.

 

Sexual reproduction in basidiomycetes is similar to that of the ascomycetes. Compatible haploid hyphae fuse to produce a dikaryotic mycelium. However, the dikaryotic phase is more extensive in the basidiomycetes, often also present in the vegetatively growing mycelium. A specialized anatomical structure, called a clamp connection, is formed at each hyphal septum. As with the structurally similar hook in the ascomycetes, the clamp connection in the basidiomycetes is required for controlled transfer of nuclei during cell division, to maintain the dikaryotic stage with two genetically different nuclei in each hyphal compartment. A basidiocarp is formed in which club-like structures known as basidia generate haploid basidiospores after karyogamy and meiosis. The most commonly known basidiocarps are mushrooms, but they may also take other forms (see Morphology section).

 

In fungi formerly classified as Zygomycota, haploid hyphae of two individuals fuse, forming a gametangium, a specialized cell structure that becomes a fertile gamete-producing cell. The gametangium develops into a zygospore, a thick-walled spore formed by the union of gametes. When the zygospore germinates, it undergoes meiosis, generating new haploid hyphae, which may then form asexual sporangiospores. These sporangiospores allow the fungus to rapidly disperse and germinate into new genetically identical haploid fungal mycelia.

 

Spore dispersal

The spores of most of the researched species of fungi are transported by wind. Such species often produce dry or hydrophobic spores that do not absorb water and are readily scattered by raindrops, for example. In other species, both asexual and sexual spores or sporangiospores are often actively dispersed by forcible ejection from their reproductive structures. This ejection ensures exit of the spores from the reproductive structures as well as traveling through the air over long distances.

 

Specialized mechanical and physiological mechanisms, as well as spore surface structures (such as hydrophobins), enable efficient spore ejection. For example, the structure of the spore-bearing cells in some ascomycete species is such that the buildup of substances affecting cell volume and fluid balance enables the explosive discharge of spores into the air. The forcible discharge of single spores termed ballistospores involves formation of a small drop of water (Buller's drop), which upon contact with the spore leads to its projectile release with an initial acceleration of more than 10,000 g; the net result is that the spore is ejected 0.01–0.02 cm, sufficient distance for it to fall through the gills or pores into the air below. Other fungi, like the puffballs, rely on alternative mechanisms for spore release, such as external mechanical forces. The hydnoid fungi (tooth fungi) produce spores on pendant, tooth-like or spine-like projections. The bird's nest fungi use the force of falling water drops to liberate the spores from cup-shaped fruiting bodies. Another strategy is seen in the stinkhorns, a group of fungi with lively colors and putrid odor that attract insects to disperse their spores.

 

Homothallism

In homothallic sexual reproduction, two haploid nuclei derived from the same individual fuse to form a zygote that can then undergo meiosis. Homothallic fungi include species with an Aspergillus-like asexual stage (anamorphs) occurring in numerous different genera, several species of the ascomycete genus Cochliobolus, and the ascomycete Pneumocystis jirovecii. The earliest mode of sexual reproduction among eukaryotes was likely homothallism, that is, self-fertile unisexual reproduction.

 

Other sexual processes

Besides regular sexual reproduction with meiosis, certain fungi, such as those in the genera Penicillium and Aspergillus, may exchange genetic material via parasexual processes, initiated by anastomosis between hyphae and plasmogamy of fungal cells. The frequency and relative importance of parasexual events is unclear and may be lower than other sexual processes. It is known to play a role in intraspecific hybridization and is likely required for hybridization between species, which has been associated with major events in fungal evolution.

 

Evolution

In contrast to plants and animals, the early fossil record of the fungi is meager. Factors that likely contribute to the under-representation of fungal species among fossils include the nature of fungal fruiting bodies, which are soft, fleshy, and easily degradable tissues and the microscopic dimensions of most fungal structures, which therefore are not readily evident. Fungal fossils are difficult to distinguish from those of other microbes, and are most easily identified when they resemble extant fungi. Often recovered from a permineralized plant or animal host, these samples are typically studied by making thin-section preparations that can be examined with light microscopy or transmission electron microscopy. Researchers study compression fossils by dissolving the surrounding matrix with acid and then using light or scanning electron microscopy to examine surface details.

 

The earliest fossils possessing features typical of fungi date to the Paleoproterozoic era, some 2,400 million years ago (Ma); these multicellular benthic organisms had filamentous structures capable of anastomosis. Other studies (2009) estimate the arrival of fungal organisms at about 760–1060 Ma on the basis of comparisons of the rate of evolution in closely related groups. The oldest fossilizied mycelium to be identified from its molecular composition is between 715 and 810 million years old. For much of the Paleozoic Era (542–251 Ma), the fungi appear to have been aquatic and consisted of organisms similar to the extant chytrids in having flagellum-bearing spores. The evolutionary adaptation from an aquatic to a terrestrial lifestyle necessitated a diversification of ecological strategies for obtaining nutrients, including parasitism, saprobism, and the development of mutualistic relationships such as mycorrhiza and lichenization. Studies suggest that the ancestral ecological state of the Ascomycota was saprobism, and that independent lichenization events have occurred multiple times.

 

In May 2019, scientists reported the discovery of a fossilized fungus, named Ourasphaira giraldae, in the Canadian Arctic, that may have grown on land a billion years ago, well before plants were living on land. Pyritized fungus-like microfossils preserved in the basal Ediacaran Doushantuo Formation (~635 Ma) have been reported in South China. Earlier, it had been presumed that the fungi colonized the land during the Cambrian (542–488.3 Ma), also long before land plants. Fossilized hyphae and spores recovered from the Ordovician of Wisconsin (460 Ma) resemble modern-day Glomerales, and existed at a time when the land flora likely consisted of only non-vascular bryophyte-like plants. Prototaxites, which was probably a fungus or lichen, would have been the tallest organism of the late Silurian and early Devonian. Fungal fossils do not become common and uncontroversial until the early Devonian (416–359.2 Ma), when they occur abundantly in the Rhynie chert, mostly as Zygomycota and Chytridiomycota. At about this same time, approximately 400 Ma, the Ascomycota and Basidiomycota diverged, and all modern classes of fungi were present by the Late Carboniferous (Pennsylvanian, 318.1–299 Ma).

 

Lichens formed a component of the early terrestrial ecosystems, and the estimated age of the oldest terrestrial lichen fossil is 415 Ma; this date roughly corresponds to the age of the oldest known sporocarp fossil, a Paleopyrenomycites species found in the Rhynie Chert. The oldest fossil with microscopic features resembling modern-day basidiomycetes is Palaeoancistrus, found permineralized with a fern from the Pennsylvanian. Rare in the fossil record are the Homobasidiomycetes (a taxon roughly equivalent to the mushroom-producing species of the Agaricomycetes). Two amber-preserved specimens provide evidence that the earliest known mushroom-forming fungi (the extinct species Archaeomarasmius leggetti) appeared during the late Cretaceous, 90 Ma.

 

Some time after the Permian–Triassic extinction event (251.4 Ma), a fungal spike (originally thought to be an extraordinary abundance of fungal spores in sediments) formed, suggesting that fungi were the dominant life form at this time, representing nearly 100% of the available fossil record for this period. However, the relative proportion of fungal spores relative to spores formed by algal species is difficult to assess, the spike did not appear worldwide, and in many places it did not fall on the Permian–Triassic boundary.

 

Sixty-five million years ago, immediately after the Cretaceous–Paleogene extinction event that famously killed off most dinosaurs, there was a dramatic increase in evidence of fungi; apparently the death of most plant and animal species led to a huge fungal bloom like "a massive compost heap".

 

Taxonomy

Although commonly included in botany curricula and textbooks, fungi are more closely related to animals than to plants and are placed with the animals in the monophyletic group of opisthokonts. Analyses using molecular phylogenetics support a monophyletic origin of fungi. The taxonomy of fungi is in a state of constant flux, especially due to research based on DNA comparisons. These current phylogenetic analyses often overturn classifications based on older and sometimes less discriminative methods based on morphological features and biological species concepts obtained from experimental matings.

 

There is no unique generally accepted system at the higher taxonomic levels and there are frequent name changes at every level, from species upwards. Efforts among researchers are now underway to establish and encourage usage of a unified and more consistent nomenclature. Until relatively recent (2012) changes to the International Code of Nomenclature for algae, fungi and plants, fungal species could also have multiple scientific names depending on their life cycle and mode (sexual or asexual) of reproduction. Web sites such as Index Fungorum and MycoBank are officially recognized nomenclatural repositories and list current names of fungal species (with cross-references to older synonyms).

 

The 2007 classification of Kingdom Fungi is the result of a large-scale collaborative research effort involving dozens of mycologists and other scientists working on fungal taxonomy. It recognizes seven phyla, two of which—the Ascomycota and the Basidiomycota—are contained within a branch representing subkingdom Dikarya, the most species rich and familiar group, including all the mushrooms, most food-spoilage molds, most plant pathogenic fungi, and the beer, wine, and bread yeasts. The accompanying cladogram depicts the major fungal taxa and their relationship to opisthokont and unikont organisms, based on the work of Philippe Silar, "The Mycota: A Comprehensive Treatise on Fungi as Experimental Systems for Basic and Applied Research" and Tedersoo et al. 2018. The lengths of the branches are not proportional to evolutionary distances.

 

The major phyla (sometimes called divisions) of fungi have been classified mainly on the basis of characteristics of their sexual reproductive structures. As of 2019, nine major lineages have been identified: Opisthosporidia, Chytridiomycota, Neocallimastigomycota, Blastocladiomycota, Zoopagomycotina, Mucoromycota, Glomeromycota, Ascomycota and Basidiomycota.

 

Phylogenetic analysis has demonstrated that the Microsporidia, unicellular parasites of animals and protists, are fairly recent and highly derived endobiotic fungi (living within the tissue of another species). Previously considered to be "primitive" protozoa, they are now thought to be either a basal branch of the Fungi, or a sister group–each other's closest evolutionary relative.

 

The Chytridiomycota are commonly known as chytrids. These fungi are distributed worldwide. Chytrids and their close relatives Neocallimastigomycota and Blastocladiomycota (below) are the only fungi with active motility, producing zoospores that are capable of active movement through aqueous phases with a single flagellum, leading early taxonomists to classify them as protists. Molecular phylogenies, inferred from rRNA sequences in ribosomes, suggest that the Chytrids are a basal group divergent from the other fungal phyla, consisting of four major clades with suggestive evidence for paraphyly or possibly polyphyly.

 

The Blastocladiomycota were previously considered a taxonomic clade within the Chytridiomycota. Molecular data and ultrastructural characteristics, however, place the Blastocladiomycota as a sister clade to the Zygomycota, Glomeromycota, and Dikarya (Ascomycota and Basidiomycota). The blastocladiomycetes are saprotrophs, feeding on decomposing organic matter, and they are parasites of all eukaryotic groups. Unlike their close relatives, the chytrids, most of which exhibit zygotic meiosis, the blastocladiomycetes undergo sporic meiosis.

 

The Neocallimastigomycota were earlier placed in the phylum Chytridiomycota. Members of this small phylum are anaerobic organisms, living in the digestive system of larger herbivorous mammals and in other terrestrial and aquatic environments enriched in cellulose (e.g., domestic waste landfill sites). They lack mitochondria but contain hydrogenosomes of mitochondrial origin. As in the related chrytrids, neocallimastigomycetes form zoospores that are posteriorly uniflagellate or polyflagellate.

 

Microscopic view of a layer of translucent grayish cells, some containing small dark-color spheres

Arbuscular mycorrhiza seen under microscope. Flax root cortical cells containing paired arbuscules.

Cross-section of a cup-shaped structure showing locations of developing meiotic asci (upper edge of cup, left side, arrows pointing to two gray cells containing four and two small circles), sterile hyphae (upper edge of cup, right side, arrows pointing to white cells with a single small circle in them), and mature asci (upper edge of cup, pointing to two gray cells with eight small circles in them)

Diagram of an apothecium (the typical cup-like reproductive structure of Ascomycetes) showing sterile tissues as well as developing and mature asci.

Members of the Glomeromycota form arbuscular mycorrhizae, a form of mutualist symbiosis wherein fungal hyphae invade plant root cells and both species benefit from the resulting increased supply of nutrients. All known Glomeromycota species reproduce asexually. The symbiotic association between the Glomeromycota and plants is ancient, with evidence dating to 400 million years ago. Formerly part of the Zygomycota (commonly known as 'sugar' and 'pin' molds), the Glomeromycota were elevated to phylum status in 2001 and now replace the older phylum Zygomycota. Fungi that were placed in the Zygomycota are now being reassigned to the Glomeromycota, or the subphyla incertae sedis Mucoromycotina, Kickxellomycotina, the Zoopagomycotina and the Entomophthoromycotina. Some well-known examples of fungi formerly in the Zygomycota include black bread mold (Rhizopus stolonifer), and Pilobolus species, capable of ejecting spores several meters through the air. Medically relevant genera include Mucor, Rhizomucor, and Rhizopus.

 

The Ascomycota, commonly known as sac fungi or ascomycetes, constitute the largest taxonomic group within the Eumycota. These fungi form meiotic spores called ascospores, which are enclosed in a special sac-like structure called an ascus. This phylum includes morels, a few mushrooms and truffles, unicellular yeasts (e.g., of the genera Saccharomyces, Kluyveromyces, Pichia, and Candida), and many filamentous fungi living as saprotrophs, parasites, and mutualistic symbionts (e.g. lichens). Prominent and important genera of filamentous ascomycetes include Aspergillus, Penicillium, Fusarium, and Claviceps. Many ascomycete species have only been observed undergoing asexual reproduction (called anamorphic species), but analysis of molecular data has often been able to identify their closest teleomorphs in the Ascomycota. Because the products of meiosis are retained within the sac-like ascus, ascomycetes have been used for elucidating principles of genetics and heredity (e.g., Neurospora crassa).

 

Members of the Basidiomycota, commonly known as the club fungi or basidiomycetes, produce meiospores called basidiospores on club-like stalks called basidia. Most common mushrooms belong to this group, as well as rust and smut fungi, which are major pathogens of grains. Other important basidiomycetes include the maize pathogen Ustilago maydis, human commensal species of the genus Malassezia, and the opportunistic human pathogen, Cryptococcus neoformans.

 

Fungus-like organisms

Because of similarities in morphology and lifestyle, the slime molds (mycetozoans, plasmodiophorids, acrasids, Fonticula and labyrinthulids, now in Amoebozoa, Rhizaria, Excavata, Opisthokonta and Stramenopiles, respectively), water molds (oomycetes) and hyphochytrids (both Stramenopiles) were formerly classified in the kingdom Fungi, in groups like Mastigomycotina, Gymnomycota and Phycomycetes. The slime molds were studied also as protozoans, leading to an ambiregnal, duplicated taxonomy.

 

Unlike true fungi, the cell walls of oomycetes contain cellulose and lack chitin. Hyphochytrids have both chitin and cellulose. Slime molds lack a cell wall during the assimilative phase (except labyrinthulids, which have a wall of scales), and take in nutrients by ingestion (phagocytosis, except labyrinthulids) rather than absorption (osmotrophy, as fungi, labyrinthulids, oomycetes and hyphochytrids). Neither water molds nor slime molds are closely related to the true fungi, and, therefore, taxonomists no longer group them in the kingdom Fungi. Nonetheless, studies of the oomycetes and myxomycetes are still often included in mycology textbooks and primary research literature.

 

The Eccrinales and Amoebidiales are opisthokont protists, previously thought to be zygomycete fungi. Other groups now in Opisthokonta (e.g., Corallochytrium, Ichthyosporea) were also at given time classified as fungi. The genus Blastocystis, now in Stramenopiles, was originally classified as a yeast. Ellobiopsis, now in Alveolata, was considered a chytrid. The bacteria were also included in fungi in some classifications, as the group Schizomycetes.

 

The Rozellida clade, including the "ex-chytrid" Rozella, is a genetically disparate group known mostly from environmental DNA sequences that is a sister group to fungi. Members of the group that have been isolated lack the chitinous cell wall that is characteristic of fungi. Alternatively, Rozella can be classified as a basal fungal group.

 

The nucleariids may be the next sister group to the eumycete clade, and as such could be included in an expanded fungal kingdom. Many Actinomycetales (Actinomycetota), a group with many filamentous bacteria, were also long believed to be fungi.

 

Ecology

Although often inconspicuous, fungi occur in every environment on Earth and play very important roles in most ecosystems. Along with bacteria, fungi are the major decomposers in most terrestrial (and some aquatic) ecosystems, and therefore play a critical role in biogeochemical cycles and in many food webs. As decomposers, they play an essential role in nutrient cycling, especially as saprotrophs and symbionts, degrading organic matter to inorganic molecules, which can then re-enter anabolic metabolic pathways in plants or other organisms.

 

Symbiosis

Many fungi have important symbiotic relationships with organisms from most if not all kingdoms. These interactions can be mutualistic or antagonistic in nature, or in the case of commensal fungi are of no apparent benefit or detriment to the host.

 

With plants

Mycorrhizal symbiosis between plants and fungi is one of the most well-known plant–fungus associations and is of significant importance for plant growth and persistence in many ecosystems; over 90% of all plant species engage in mycorrhizal relationships with fungi and are dependent upon this relationship for survival.

 

A microscopic view of blue-stained cells, some with dark wavy lines in them

The dark filaments are hyphae of the endophytic fungus Epichloë coenophiala in the intercellular spaces of tall fescue leaf sheath tissue

The mycorrhizal symbiosis is ancient, dating back to at least 400 million years. It often increases the plant's uptake of inorganic compounds, such as nitrate and phosphate from soils having low concentrations of these key plant nutrients. The fungal partners may also mediate plant-to-plant transfer of carbohydrates and other nutrients. Such mycorrhizal communities are called "common mycorrhizal networks". A special case of mycorrhiza is myco-heterotrophy, whereby the plant parasitizes the fungus, obtaining all of its nutrients from its fungal symbiont. Some fungal species inhabit the tissues inside roots, stems, and leaves, in which case they are called endophytes. Similar to mycorrhiza, endophytic colonization by fungi may benefit both symbionts; for example, endophytes of grasses impart to their host increased resistance to herbivores and other environmental stresses and receive food and shelter from the plant in return.

 

With algae and cyanobacteria

A green, leaf-like structure attached to a tree, with a pattern of ridges and depression on the bottom surface

The lichen Lobaria pulmonaria, a symbiosis of fungal, algal, and cyanobacterial species

Lichens are a symbiotic relationship between fungi and photosynthetic algae or cyanobacteria. The photosynthetic partner in the relationship is referred to in lichen terminology as a "photobiont". The fungal part of the relationship is composed mostly of various species of ascomycetes and a few basidiomycetes. Lichens occur in every ecosystem on all continents, play a key role in soil formation and the initiation of biological succession, and are prominent in some extreme environments, including polar, alpine, and semiarid desert regions. They are able to grow on inhospitable surfaces, including bare soil, rocks, tree bark, wood, shells, barnacles and leaves. As in mycorrhizas, the photobiont provides sugars and other carbohydrates via photosynthesis to the fungus, while the fungus provides minerals and water to the photobiont. The functions of both symbiotic organisms are so closely intertwined that they function almost as a single organism; in most cases the resulting organism differs greatly from the individual components. Lichenization is a common mode of nutrition for fungi; around 27% of known fungi—more than 19,400 species—are lichenized. Characteristics common to most lichens include obtaining organic carbon by photosynthesis, slow growth, small size, long life, long-lasting (seasonal) vegetative reproductive structures, mineral nutrition obtained largely from airborne sources, and greater tolerance of desiccation than most other photosynthetic organisms in the same habitat.

 

With insects

Many insects also engage in mutualistic relationships with fungi. Several groups of ants cultivate fungi in the order Chaetothyriales for several purposes: as a food source, as a structural component of their nests, and as a part of an ant/plant symbiosis in the domatia (tiny chambers in plants that house arthropods). Ambrosia beetles cultivate various species of fungi in the bark of trees that they infest. Likewise, females of several wood wasp species (genus Sirex) inject their eggs together with spores of the wood-rotting fungus Amylostereum areolatum into the sapwood of pine trees; the growth of the fungus provides ideal nutritional conditions for the development of the wasp larvae. At least one species of stingless bee has a relationship with a fungus in the genus Monascus, where the larvae consume and depend on fungus transferred from old to new nests. Termites on the African savannah are also known to cultivate fungi, and yeasts of the genera Candida and Lachancea inhabit the gut of a wide range of insects, including neuropterans, beetles, and cockroaches; it is not known whether these fungi benefit their hosts. Fungi growing in dead wood are essential for xylophagous insects (e.g. woodboring beetles). They deliver nutrients needed by xylophages to nutritionally scarce dead wood. Thanks to this nutritional enrichment the larvae of the woodboring insect is able to grow and develop to adulthood. The larvae of many families of fungicolous flies, particularly those within the superfamily Sciaroidea such as the Mycetophilidae and some Keroplatidae feed on fungal fruiting bodies and sterile mycorrhizae.

 

A thin brown stick positioned horizontally with roughly two dozen clustered orange-red leaves originating from a single point in the middle of the stick. These orange leaves are three to four times larger than the few other green leaves growing out of the stick, and are covered on the lower leaf surface with hundreds of tiny bumps. The background shows the green leaves and branches of neighboring shrubs.

The plant pathogen Puccinia magellanicum (calafate rust) causes the defect known as witch's broom, seen here on a barberry shrub in Chile.

 

Gram stain of Candida albicans from a vaginal swab from a woman with candidiasis, showing hyphae, and chlamydospores, which are 2–4 µm in diameter.

Many fungi are parasites on plants, animals (including humans), and other fungi. Serious pathogens of many cultivated plants causing extensive damage and losses to agriculture and forestry include the rice blast fungus Magnaporthe oryzae, tree pathogens such as Ophiostoma ulmi and Ophiostoma novo-ulmi causing Dutch elm disease, Cryphonectria parasitica responsible for chestnut blight, and Phymatotrichopsis omnivora causing Texas Root Rot, and plant pathogens in the genera Fusarium, Ustilago, Alternaria, and Cochliobolus. Some carnivorous fungi, like Paecilomyces lilacinus, are predators of nematodes, which they capture using an array of specialized structures such as constricting rings or adhesive nets. Many fungi that are plant pathogens, such as Magnaporthe oryzae, can switch from being biotrophic (parasitic on living plants) to being necrotrophic (feeding on the dead tissues of plants they have killed). This same principle is applied to fungi-feeding parasites, including Asterotremella albida, which feeds on the fruit bodies of other fungi both while they are living and after they are dead.

 

Some fungi can cause serious diseases in humans, several of which may be fatal if untreated. These include aspergillosis, candidiasis, coccidioidomycosis, cryptococcosis, histoplasmosis, mycetomas, and paracoccidioidomycosis. Furthermore, persons with immuno-deficiencies are particularly susceptible to disease by genera such as Aspergillus, Candida, Cryptoccocus, Histoplasma, and Pneumocystis. Other fungi can attack eyes, nails, hair, and especially skin, the so-called dermatophytic and keratinophilic fungi, and cause local infections such as ringworm and athlete's foot. Fungal spores are also a cause of allergies, and fungi from different taxonomic groups can evoke allergic reactions.

 

As targets of mycoparasites

Organisms that parasitize fungi are known as mycoparasitic organisms. About 300 species of fungi and fungus-like organisms, belonging to 13 classes and 113 genera, are used as biocontrol agents against plant fungal diseases. Fungi can also act as mycoparasites or antagonists of other fungi, such as Hypomyces chrysospermus, which grows on bolete mushrooms. Fungi can also become the target of infection by mycoviruses.

 

Communication

Main article: Mycorrhizal networks

There appears to be electrical communication between fungi in word-like components according to spiking characteristics.

 

Possible impact on climate

According to a study published in the academic journal Current Biology, fungi can soak from the atmosphere around 36% of global fossil fuel greenhouse gas emissions.

 

Mycotoxins

(6aR,9R)-N-((2R,5S,10aS,10bS)-5-benzyl-10b-hydroxy-2-methyl-3,6-dioxooctahydro-2H-oxazolo[3,2-a] pyrrolo[2,1-c]pyrazin-2-yl)-7-methyl-4,6,6a,7,8,9-hexahydroindolo[4,3-fg] quinoline-9-carboxamide

Ergotamine, a major mycotoxin produced by Claviceps species, which if ingested can cause gangrene, convulsions, and hallucinations

Many fungi produce biologically active compounds, several of which are toxic to animals or plants and are therefore called mycotoxins. Of particular relevance to humans are mycotoxins produced by molds causing food spoilage, and poisonous mushrooms (see above). Particularly infamous are the lethal amatoxins in some Amanita mushrooms, and ergot alkaloids, which have a long history of causing serious epidemics of ergotism (St Anthony's Fire) in people consuming rye or related cereals contaminated with sclerotia of the ergot fungus, Claviceps purpurea. Other notable mycotoxins include the aflatoxins, which are insidious liver toxins and highly carcinogenic metabolites produced by certain Aspergillus species often growing in or on grains and nuts consumed by humans, ochratoxins, patulin, and trichothecenes (e.g., T-2 mycotoxin) and fumonisins, which have significant impact on human food supplies or animal livestock.

 

Mycotoxins are secondary metabolites (or natural products), and research has established the existence of biochemical pathways solely for the purpose of producing mycotoxins and other natural products in fungi. Mycotoxins may provide fitness benefits in terms of physiological adaptation, competition with other microbes and fungi, and protection from consumption (fungivory). Many fungal secondary metabolites (or derivatives) are used medically, as described under Human use below.

 

Pathogenic mechanisms

Ustilago maydis is a pathogenic plant fungus that causes smut disease in maize and teosinte. Plants have evolved efficient defense systems against pathogenic microbes such as U. maydis. A rapid defense reaction after pathogen attack is the oxidative burst where the plant produces reactive oxygen species at the site of the attempted invasion. U. maydis can respond to the oxidative burst with an oxidative stress response, regulated by the gene YAP1. The response protects U. maydis from the host defense, and is necessary for the pathogen's virulence. Furthermore, U. maydis has a well-established recombinational DNA repair system which acts during mitosis and meiosis. The system may assist the pathogen in surviving DNA damage arising from the host plant's oxidative defensive response to infection.

 

Cryptococcus neoformans is an encapsulated yeast that can live in both plants and animals. C. neoformans usually infects the lungs, where it is phagocytosed by alveolar macrophages. Some C. neoformans can survive inside macrophages, which appears to be the basis for latency, disseminated disease, and resistance to antifungal agents. One mechanism by which C. neoformans survives the hostile macrophage environment is by up-regulating the expression of genes involved in the oxidative stress response. Another mechanism involves meiosis. The majority of C. neoformans are mating "type a". Filaments of mating "type a" ordinarily have haploid nuclei, but they can become diploid (perhaps by endoduplication or by stimulated nuclear fusion) to form blastospores. The diploid nuclei of blastospores can undergo meiosis, including recombination, to form haploid basidiospores that can be dispersed. This process is referred to as monokaryotic fruiting. This process requires a gene called DMC1, which is a conserved homologue of genes recA in bacteria and RAD51 in eukaryotes, that mediates homologous chromosome pairing during meiosis and repair of DNA double-strand breaks. Thus, C. neoformans can undergo a meiosis, monokaryotic fruiting, that promotes recombinational repair in the oxidative, DNA damaging environment of the host macrophage, and the repair capability may contribute to its virulence.

 

Human use

See also: Human interactions with fungi

Microscopic view of five spherical structures; one of the spheres is considerably smaller than the rest and attached to one of the larger spheres

Saccharomyces cerevisiae cells shown with DIC microscopy

The human use of fungi for food preparation or preservation and other purposes is extensive and has a long history. Mushroom farming and mushroom gathering are large industries in many countries. The study of the historical uses and sociological impact of fungi is known as ethnomycology. Because of the capacity of this group to produce an enormous range of natural products with antimicrobial or other biological activities, many species have long been used or are being developed for industrial production of antibiotics, vitamins, and anti-cancer and cholesterol-lowering drugs. Methods have been developed for genetic engineering of fungi, enabling metabolic engineering of fungal species. For example, genetic modification of yeast species—which are easy to grow at fast rates in large fermentation vessels—has opened up ways of pharmaceutical production that are potentially more efficient than production by the original source organisms. Fungi-based industries are sometimes considered to be a major part of a growing bioeconomy, with applications under research and development including use for textiles, meat substitution and general fungal biotechnology.

 

Therapeutic uses

Modern chemotherapeutics

Many species produce metabolites that are major sources of pharmacologically active drugs.

 

Antibiotics

Particularly important are the antibiotics, including the penicillins, a structurally related group of β-lactam antibiotics that are synthesized from small peptides. Although naturally occurring penicillins such as penicillin G (produced by Penicillium chrysogenum) have a relatively narrow spectrum of biological activity, a wide range of other penicillins can be produced by chemical modification of the natural penicillins. Modern penicillins are semisynthetic compounds, obtained initially from fermentation cultures, but then structurally altered for specific desirable properties. Other antibiotics produced by fungi include: ciclosporin, commonly used as an immunosuppressant during transplant surgery; and fusidic acid, used to help control infection from methicillin-resistant Staphylococcus aureus bacteria. Widespread use of antibiotics for the treatment of bacterial diseases, such as tuberculosis, syphilis, leprosy, and others began in the early 20th century and continues to date. In nature, antibiotics of fungal or bacterial origin appear to play a dual role: at high concentrations they act as chemical defense against competition with other microorganisms in species-rich environments, such as the rhizosphere, and at low concentrations as quorum-sensing molecules for intra- or interspecies signaling.

 

Other

Other drugs produced by fungi include griseofulvin isolated from Penicillium griseofulvum, used to treat fungal infections, and statins (HMG-CoA reductase inhibitors), used to inhibit cholesterol synthesis. Examples of statins found in fungi include mevastatin from Penicillium citrinum and lovastatin from Aspergillus terreus and the oyster mushroom. Psilocybin from fungi is investigated for therapeutic use and appears to cause global increases in brain network integration. Fungi produce compounds that inhibit viruses and cancer cells. Specific metabolites, such as polysaccharide-K, ergotamine, and β-lactam antibiotics, are routinely used in clinical medicine. The shiitake mushroom is a source of lentinan, a clinical drug approved for use in cancer treatments in several countries, including Japan. In Europe and Japan, polysaccharide-K (brand name Krestin), a chemical derived from Trametes versicolor, is an approved adjuvant for cancer therapy.

 

Traditional medicine

Upper surface view of a kidney-shaped fungus, brownish-red with a lighter yellow-brown margin, and a somewhat varnished or shiny appearance

Two dried yellow-orange caterpillars, one with a curly grayish fungus growing out of one of its ends. The grayish fungus is roughly equal to or slightly greater in length than the caterpillar, and tapers in thickness to a narrow end.

The fungi Ganoderma lucidum (left) and Ophiocordyceps sinensis (right) are used in traditional medicine practices

Certain mushrooms are used as supposed therapeutics in folk medicine practices, such as traditional Chinese medicine. Mushrooms with a history of such use include Agaricus subrufescens, Ganoderma lucidum, and Ophiocordyceps sinensis.

 

Cultured foods

Baker's yeast or Saccharomyces cerevisiae, a unicellular fungus, is used to make bread and other wheat-based products, such as pizza dough and dumplings. Yeast species of the genus Saccharomyces are also used to produce alcoholic beverages through fermentation. Shoyu koji mold (Aspergillus oryzae) is an essential ingredient in brewing Shoyu (soy sauce) and sake, and the preparation of miso while Rhizopus species are used for making tempeh. Several of these fungi are domesticated species that were bred or selected according to their capacity to ferment food without producing harmful mycotoxins (see below), which are produced by very closely related Aspergilli. Quorn, a meat substitute, is made from Fusarium venenatum.

What are the benefits and advantages of Virgin Coconut Oil to Your Health ?

 

Why drink Virgin Coconut Oil? (Must read) Sinusitis & Alergy, Chronic Tiredness & Asthma

Protection from disease Dandruff and hair fall

Advantages of VCO & Metabolism and Energy Remove excess fat- Obesity

Remedial, Substance digestion and absorption Prostate Enlargement, Ulcer and constipation

Mother's milk & MCFA,pregnancy & Your baby Acute myocardial infarction deterrent

Anti aging, Scars on skin elasticity, Protect & treat skin High blood & Diabetes

Cracked heel, Accident wound, wound and sore Cancer , AIDS Treatment & other Researches

         

Prof.Dr.Mary G.Enig Director, Nutritional Science Division,

Enig Associates, Inc. 11120 New Hampshire Avenue

500 Silver Spring, MD 20904-2633 U.S.

 

"Coconut oil is the important and beneficial food for 21st century . With the availability of clinical and scientific information of its healthy qualities of antimicrobial virgin coconut oil particularly and coconut oil in generally, makes it very attractive."

    

“Virgin Coconut Oil is most salutary oil in the world"

 

Dr. Bruce Fife (Doctor Naturopati – USA)

   

" Virgin Coconut Oil has anti virus, anti bacteria, anti fungus and anti natural parasite characteristics can control a variety of diseases "

 

Dr. John J. Kabara (Universiti Michigan –USA)

   

" Virgin coconut oil stand strong alone as the most salutary oil that you can use. It contains nutritional value and research treasure that is really valuable. I really indeed want you make virgin coconut oil as part of your daily nutrition's plan "

Dr. Mark Atkinson, Holistic Medical Physician

 

MBBS Bsc (Hons) FRIPHH FCMA BETD SAC DIP

 

(Clinical Nutrition)

     

Dr Joseph Mercola

(Author of Total Health Programand Rachael Droege)

  

6 ways for your

 

skin to really look young

   

1-Control from excessive exposure to sunlight.

2-Avoid from practicing a 'yo-yo diet'.

3-Use Virgin Coconut Oil

Using virgin coconut oil as a lotion is the ideal method to control your skin's youthfulness. It does not only prevent the formation of harmful free radicals, but it also act to protect it from free radical. In fact it is also capable of sustaining the skin from whitehead and other skin problem due to aging factor and excessive exposure to sunlight.

Virgin coconut oil is capable of strengthening the 'connective' tissue of the skin, thereby helping to stop the skin from slack and wrinkle. It contains certain elements that is capable of restoring damaged skin or preventing the skin from contracting a disease.

Virgin coconut oil not only give temporary relief to the skin, but it also helps to restore and improve the skin, and that cannot be done by any other types of lotion. It functioned to r5estore the youthfulness of your skin by removing the external dead skin cells. Virgin coconut oil will penetrate deep into the underlayer skin and will reinforce that layer of tissue. Finally your skin will be soft and healthy.

If you want the maximum restorative effect, you must choose those oil that is genuinely of high quality, free from chemicals, no bleaching and non hydrogenated. All these are available in virgin coconut oil.

4-Rest your face muscles

5-Take plenty of Omega-3.

6-Avoid smoking.

         

Hj.Ishak Basiran

(Mechanical Engineer)

M.Director Desaku Maju Marketing, Desaku Trading, Mudah Niaga & Teknologi Desa Hijau Sdn Bhd.

Dr.AH.Bambang Setiaji, MSc

(Expert Virgin Coconut oil Nusantara)

Lecturer Fakulti Kimia Matematik dan Ilmu Pengetahuan Alam Universiti Gadjah Mada Indonesia

             

Everyday drink Virgin Coconut Oil @ Black Seed Oil @ Honey- What you will get?

 

Relieve breathing– dilute phlegm and cleanse the respiratory tract and throat.

  

Ease defecation and urination – overcome constipation & uncomfortable urination and remove toxin through excrement.

  

Increase the metabolism rate on the whole body cells– Virgin coconut oil will be diffused on as the energy component inside the body – your body will consider stronger.

  

In the ileum and colon, it destroys the harmful organism like viruses, bacteria, fungi and protozoan (worm). The digestion will achieve maximum level.

  

Reduce the condition of being easily hungry – when the digestion achieves maximum level, the body will gain more nutrition and energy.

  

Therefore the body weight is controlled – don't need to eat much and often.

  

Reduce body fat – the body weight decreases to suit the person's body.

 

Not easily infected by diseases – with the strengthening of the body immunity system.

  

Reduce the stickiness of the blood platelet – the stickiness of the platelet is the contributing factor of the plaque formation in the blood vessel.

  

Reduce the risk of heart attack and high blood pressure – avoid the formation of plaque in the blood vessel especially the blood vessel to the heart.

 

Speeds up the process of repairing the damaged cells – restore the flexibility, tenderness and fineness of skin.

  

THE LONG TERM EFFECT ON THE BODY FOR CONSUMING VIRGIN COCONUT OIL

 

Reduce the cholesterol level – it does not contain cholesterol. Therefore it is the best alternative to other oils that have high high cholesterol level.

 

Control diabetes - the pancreas is more efficient to secrete insulin while the cell work more efficiently to diffuse the needed sugar.

 

Overcome degenerative disease and old age problem - the natural anti oxidant in virgin coconut oil is the free radical formation obstructer.

 

Does not increase the stickiness level of platelet in the blood – overcome plaque formation in the vessel which is the factor of heart attack.

 

The body is more resistant to diseases because VCO has anti virus, anti bacteria, anti fungus and anti protozoan agents.

 

Restore the flexibility, softness of skin – it speeds up the process of building new cells, besides protecting it from ultra violet radiation.

 

Stimulate new hair growth and guard against dandruff –the hair cell will gain adequate energy and nutrients for maximum growth.

 

Prevent allergy – virgin coconut oil acts as an anti histamine agent.

 

Prevent the risk of cancer disease – virgin coconut oil destroys the presence of any pathogen. Therefore leucocytes can act maximally destroy the cancer cells, because the leucocytes is not capable of attacking the pathogen organisms.

 

Overcome snoring – because the respiratory tract and uvula will be flexible and elastic due to the existence of new cells.

    

As a Source of Food, Energy and Health

   

VIRGIN COCONUT OIL

 

Ø Does not burden the pancreas

 

Ø Medium Chain Fatty Acid (MCFA – easily digested)

 

Ø Digested by only the saliva enzyme and in stomach (very good for those who have digestive disorder, metabolic problem, premature infant that the body system is under growth.

 

Ø Transmitted to the liver producing maximum energy.

 

Ø Produce instant energy. It can pass through the membrane cell of mitochondria without the enzyme.

 

Ø Cells become efficient.

 

Ø Act to prevent the formation of free radical.

 

Ø The poisonous trans fatty acid that destroy the body system is not produced.

 

Ø No cholesterol.

 

Ø Contain about 45-55 % of lauric acid.

 

Ø Have antivirus, antibacterial, antifungal, anti protozoan properties.

 

Ø On skin, it acts as the additional shield against the dangerous ultra violet (UV) radiation (longer skin's youthfulness) and prevent from the bacterial infection (prevent skin disease infection) besides speeding up the formation of new cells (flexibility and softness of skin is more obvious.

 

Ø Acts as anti cancer and anti histamine (prevent allergy).

 

Ø Increase metabolism. (Cells have more energy, makethem more efficient).

 

Ø Improve endurance.

 

Ø Improve the digestive system. (will not easily get hungry, no need to eat much and the body weight is controlled naturally).

 

Ø Improve the digestion of vitamins and minerals (good for old folks).

  

VEGETABLE OIL

 

Ø Burdening to the pancreas.

 

Ø Long Chain Fatty Acid ( only certain LCFA can be digested)

 

Ø Need pancreatic enzyme and various enzymes to be broken down into small units.

 

Ø It needs specific enzyme to enable it to permeate mitochondria membrane cell - thus it generates energy slower than Virgin Coconut Oil.

 

Ø Cells not efficient.

 

Ø Free radical is easily formed.

 

Ø It is being processed through deodorization, bleaching, dehydrogenation, which in the process, produces trans fatty acid that is known to be harmful to the human body.

 

Ø Contain cholesterol.

 

Ø Almost no beneficial acid.

             

ACUTE MYOCARDIAL INFARCTION PREVENTION

 

As explain earlier, coconut oil does not increase the blood cholesterol level or triglyceride level or excessive blood clot. It even stimulate the metabolism, thereby lowering the cholesterol level. Research result from 1970 to 1980 showed that coconut oil is good for the heart although at that time the unsaturated fat is blamed for increasing the risk of myocardial infarction. It is proven that taking coconut oil greatly influence towards the decline in the risk of myocardial infarction compared with other edible oil. Coconut oil can also reduce the accumulation of body fat, increasing lifespan, lessen blood clot formation, reduce free radicals in the cells, reduce the cholesterol level in the blood and heart, adding antioxidant in the cells and reduce the possibility of acute myocardial infarction of the society. By consuming coconut oil the risk of heart attack can be reduced.

 

Based on this evidence coconut oil therefore is good for the heart or at least harmless to the heart. However it is a fact that coconut oil is not only harmless but play an important role in fighting against acute myocardial infarction. Because of its extraordinary role, it is expected to become a new weapon in fighting against acute myocardial infarction.

   

ACUTE MYOCARDIAL INFARCTION AND HYPERTENSION

 

To understand how coconut oil can help prevent acute myocardial infarction, we must possess the basic knowledge of how a heart disease develop. Acute myocardial infarction is caused by the hardening of the arteries (atherosclerosis) that happened as a result of plaque formation. Most people say atherosclerosis is caused by too much cholesterol in the blood. This idea call cholesterol hypothesis or lipid from acute myocardial infarction. Presently this idea still is widely spread in popular media by the Soya bean industries, in fact this theory is already obsolete, with the clinical observation and academic research it had been displaced by the response to injury hypothesis.

 

What causes the formation of plaque and atherosclerosis to develop? Generally it is always thought that hardening of the vein is usually associated with cholesterol. However cholesterol does not only stay freely in the blood vessels but can settle abruptly anywhere in the vessel. Cholesterol is used by the body to patch and repair wounds on the wall of blood vessels. In fact cholesterol is not really required for the formation of plaque in the atherosclerosis. Contrary to popular belief, the key component of blood vessel plaque is not cholesterol but protein especially the network of wounds. Several blood vessels that suffer atherosclerosis contain a small amount of cholesterol or none at all. According to response to injury hypothesis, part of the atherosclerosis develop as a result of wound on the inner wall of the blood vessel. Wound can happen due several reasons such as poisoning, free radicals, virus or bacteria. If the cause of the wound is not removed, it will cause further damage and as long as the complication and inflammation continue, the network will continue developing. Blood coagulant protein called platelets circulate freely in the blood. When it meets the wound it will become sticky and stick with one another in the damaged network to facilitate remedy. This is how blood clot is form. Wound from whatever source will trigger the platelet to coagulate and the cells in the blood vessel will release element to stimulate the growth of muscle cells in the wall. A complex combination of network wound, platelet, calcium, cholesterol and triglyceride work together to cure the wound. Therefore from the fiber network, it is clear that not only cholesterol that form the basic element in plaque. Calcium accumulation in plaque caused the hardening of blood vessel and this is the characteristic of atherosclerosis.

 

Contrary to popular belief, plaque does not only stick to the internal wall along the blood vessel just like mud does in the garden hose. But plaque grow inside the wall of a blood vessel, and it is part of the wall. The wall of a blood vessel is surrounded by a layer of strong muscle fiber coiling around it to prevent the plaque from spreading. Because plaques grow and developed, but it is unable to propagate outwards, it therefore presses inwards and close the vessel passage, narrowing down the bloodstream and restricting the blood flow.

 

Platelets gather around the wound to form blood clot. It seals the vent of the damage tube. But if the blood is inclined to clot, it will finally obstruct the blood flow. Finally the vessel narrowed down by the plaque will because clog by the blood clot and this in turn will stop the blood flow. If this happen to the coronary vessel it is known as heart attack. If it happened to carotid vessel going to the brain, the result is what is called stroke. Atherosclerosis cause acute myocardial infarction and other cardiovascular interference.

     

PROSTATE ENLARGEMENT

  

Generally adult male has risk in attack prostate disruption during his life. Most common prostate disruption is benign prostaic hyperplasia (BHP) or prostate enlargement. Almost 50% old man among 40-59 year and 90% people those aged between 70-80 year stricken phenomenon BHP. The disease distributed when someone ageing. Is known that lifestyle plays a vital role happened this BHP, and it make main problem in western country. Man who lives in developed country who are less advanced where local food production and consumption usually has been undisturbed by this disease. Yet disease actual cause BHP this not yet leak. Theory most popular concentrate to male hormone dihydrostestosterone (DHT) as his cause. Believed that when we ageing greater testerone are transformed into collected DHT in prostate. Affairs this resulted prostate grow, and it pressing urethra, (fund whereby urine flowing) and bladder until cause often urinate and interference urinate, especially at night, this situation often in knit with gland inflammation. Although it is not cancer ailment, but that potential as upholder happen this disease, (cancer).

 

Medical that reasonable to BHP is by prevent change testerone become DHT. Finasteride is a medicine function by this way and has proven effective. Herb medication popular and are believed get prevent poisonous influence DHT's formation that excess is saw palmetto. This subtropical climate can found in American region South-East. Indian's person indigenous Florida and his early people use berries and this crop as medicine people to cure disruption reproduction, or vessel disease urinate and influenza. To woman are used to mother's milk and defuse menstruation painful.

 

Present research that saw palmetto berries powerfully effective in lessen disruption BHP. Relatively proscar (BHP's drug that many formulation), saw palmetto more effective in defuse prostate phenomenon. Lot of scrutiny have pointed out that saw palmetto powerfully effective almost 90% to menstrual period among week 4 to week 6 . Instead proscar only effective in defuse his phenomenon less 37% after drug taking during per years. Convince that saw palmetto had no side effects. Instead proscar may cause impotency, desire decline (libido) sexual and disabled birth. Saw palmetto have solicited his reputation among the physicians alternative health and conventional as a effective medication to BPH. It make a herb has been admitted by conventional medication as secure and effective.

 

Medication influences saw palmetto can be found especially from fat tamarind in berry. Attract to be observed that saw palmetto make cluster palm and berries and it make among coconut species. Obtain many fat tamarind to saw palmetto berries make similar MCFA with MCFA in coconut. Dr Jon Kabara, biochemist fat (lipid), declared that fat tamarind saw palmetto barriers cope pursue formation DHT hormone. Then be also with fat tamarind to coconut oil. A conclusion is necessarily equal coconut oil effective it even more effective in preventing and cure BPH like extract saw palmetto.

         

DIABETES DISEASE. (DIABETES)

 

Among a number of modern society diseases is diabetes. This disease have increased less from a century ago to the need serious attention. Now diabetes become sixth-largest killer in America. Diabetes does not just cause death but can cause other disease such as kidney pain, acute myocardial infarction, high-blood-pressure, stroke, cataract, nerve damage, hearing loss and blindness. Calculated that 45% risky inhabitants this disease (diabetes).

 

By easier diabetes are disease that related with sugar inside the body in whose know as blood sugar or blood glucose. Every cell inside body should get glucose to spur metabolic. Cell use glucose to strengthen growth process and recovery. When eat food, digestive system change a lot of food become glucose then free in bloodstream. Hormone insulin, issued by gland pancreas, arrange glucose from the blood to be channeled into the cell until operational as fuel. If cell not get glucose total that sufficient cell will become 'hunger' and finally will die. To this moment, network and organs of the body will suffer damage. That is really happened to the diabetes patient.

   

There are two types diabetes, namely diabetes type I and diabetes type II. Diabetes type I sometimes considered as diabetes youth, namely diabetes which had been dependent insulin. Diabetes this type is ordinary originated during child and it is because by incapacity pancreas to issue total insulin needed by person. While diabetes type II also known as diabetes who do not rely to insulin. Diabetes this kind only occurred when person already adult and it happen because cell not able to absorb normal rate insulin issued by pancreas. In these circumstances insulin may regard as key to a key mango to singles door. Insulin with role as key, open mango key (enter into the cell) and then open the gate to facilitate glucose enter. If his mango's key make from material that are not quality and it damage, key is no longer function, door will not be able to open. This happens to sufferer diabetes tipe II. Insulin available cannot longer open the gate because his mango's key damaged. To both type diabetes this glucose level in the blood increase whereas his cell malfunction.

 

To diabetes tipe I pancreas not able to produce insulin rate that adequate to deliver glucose ply to all cells inside body. The treatment is with make insulin injection once or more a day with sugar low nutrition table that the tight. Was reported that around 90% sufferer diabetes have been from tipe II and 85% from it caused by obesity. This both tipe diabetes, diet very important whether to patient that stay to the moment disease start though in his handling. While type of food eaten also really influence patient either it enhance or protect

 

A interesting facts, persons that stay in the archipelago Pacific who practice traditional diet never reportedly catch diabetes ill. Yet when them leave his natural food and replace him with westernized food, all manner type of disease come, and in about is diabetes. For example what that happened in Nautu Island people in South-pacific. During their centuries just rely to food based upon on banana, tuber and coconut.

 

Yet after being found in their earth phosphate patching his revenue bring to prosperity and their changing lifestyles, majority of the population replace banana, tuber and coconut with food from fine powder, sugar and vegetable oil that while his process already experienced many modify. Consequently emerge disease have never seem before it like diabetes and others. Reportedly World Health Organization (WHO), almost half Nautu's Island urban population that age 30-64 years get diabetes disease.

 

Doctors have successfully helped patients to operate diabetes with organize patient practice low-fat diet, high carbohydrate. Through diet they get limit fat intake until 30% calorie. Complex carbohydrates as perfect grain and vegetables comprise from 50% to 60% calorie. Medium carbohydrate as fine powder and sugar should avoid. This is because carbohydrate pay tension that not duly to pancreas and this will increase in blood sugar to level that jeopardizes. Reason to fat reduction and also sweet food are gaining body weight reduction. This is because body weight problem is main cause diabetes. In addition other reason to low-fat diet is reduce the acute myocardial infarction risk that general effect from diabetes illness.

 

Lastly, researchers has shown that flute vegetable oil excessive recruitment cause disease diabetes. This matter was strengthen with a proof study to on animal where it have successfully raised diabetes with only feeding fat content poly unsaturated fat that substantial. Then with only limiting fat intake, that animals has undergone remedial from his disease (diabetes). In a conclusion powerfully effective low-fat diet in the handling diabetes.

 

Latest suggestion is lessen or limit all fats. Unsaturated mono fat as olive oil, subtly influence diabetes, then approved use at reasonable rates. Yet because all fats including high olive oil caloric content, then his recruitment not are encouraged. However seem unsaturated poly oil classified oil as problem occur. This scrutiny shows that when unsaturated poly fat from diet enclose in cellular arrangement, cell ability to get disturbed glucose. In other words 'mango key' to cell open the gate supply glucose to be entered aggravate his state when too much unsaturated poly oil in take in food. Then insulin not afford open the gate. Unsaturated poly fat oxidizable easily and destroyed by free radicals. With all type of fat, including unsaturated poly oil, used as obstacle hedge supply membrane cell. Unsaturated poly fat oxidizable in membrane cell can influence by detrimental his cellular function, including his ability in permit hormone, glucose and other substance to flow into and outwards his cell. Then thereof, diet high to vegetable unsaturated poly oil distillation increase diabetes. Diet low to oil will help dispel his symptom because all fat potential to increase body weight. Then would be excellent to avoiding him.

 

In this regard still there fat which can be eaten by diabetes sufferer without foreboding. The fat is coconut oil. Coconut oil not cause diabetes and it get help arrange blood sugar, felled at lessen influence diabetes. Nautu's people take many coconut oil during several generations and was never found diabetes, yet when they replace with eating from other oil his result is disaster.

 

Attractive one item of coconut oil not claim enzyme production insulin from pancreas. With reduction to process inside the body during lunch time, whereas insulin was still being taken out with many, then would facilitate organs of the body function more efficient. Coconut oil also help give energy to cell because it have been absorbed easily without need enzyme or insulin. Coconut oil has proven can improve secretion insulin and blood glucose. Coconut oil to improving food and improve action and insulin capacity send glucose repeat among cell, when compared with other oil.

 

In Journal of the Indian Medicine Association reports that diabetes type II in India have increased when person neglect oil traditional, because more selective vegetable unsaturated poly oil that has promoted “good for the heart”. The authors having commentary on the relationship between unsaturated poly oil with diabetes and organize enhance consumption coconut oil as method to prevent diabetes.

 

A diabetes consequence are diminished energy that related with incapacity cell to get glucose that is required. Without glucose to strengthen cellular activity, metabolic becomes slow and all body fell weak.

 

Athletic were organized as a method to help diabetes sufferer operate in blood sugar. The reason why beneficial athletic is that it enhance metabolic. Faster metabolic amount will stimulate insulin production increase that is required and enhance glucose absorption in cells. Therefore it can help diabetes sufferer type I though diabetes sufferer type II.

 

Coconut oil can also increase metabolic amount that cause body fire more calories that mean will add body weight reduction. Therefore decrease body weight can do with only increasing coconut oil into the food. MCFA to coconut oil mail directly to heart are transformed into energy instead of inside the body as fat network.

 

Diabetes sufferer as good it avoiding consumption all fats, except coconut oil, because it get help stabilize blood glucose rate and help lessen excess body weight. Not extreme if reputedly that coconut oil is as good oil it eaten diabetes sufferer.

     

Ulcer and Constipation

  

Some of the ulcers are usually caused by Herpes virus simplex type 2. It will attack when the person's immunity is low such as during fever, cold, diabetes, when menstruating, stress and others, while constipation is caused by lack water, fiber, drug/chemical reaction, incorrect toilet habit, cancer of the intestine, after operation or pregnancy.

 

Generally by taking Virgin Coconut Oil it will ease the pain, besides reducing inflammation and swelling of the ulcer sufferer. The high content of lauric and capric acid in virgin coconut oil (with antimicrobial characteristics) help to enhance the body's resistance besides acting as an antibiotic in the body. For those suffering from constipation, Virgin Coconut Oil can ease the bowel and help to treat internal wound such as pile.

 

1-Web refferal :www.bio-asli.com/?id=theiqbal09

 

2-Web refferal :www.bioasli.com/?id=theiqbal09

 

3-Web refferal :www.tvbioasli.com/?ref=theiqbal09

 

4-Web refferal :www.bioasli.co.uk/?ref=theiqbal09

 

5-Web refferal :www.prepaid.bioasli.com/?ref=theiqbal09

   

Ke borang pendaftaran : www.bio-asli.com/daftar.asp?id=theiqbal09

 

English Version www.bio-asli.com/eng.asp?id=theiqbal09

      

#AMAZING Current Theories Speculate Mitochondria Cellular Powerhouses, Began as their first cousins, parasitic bacteria that eventually became beneficial www.sciencedaily.com/releases/2014/10/141016165955.htm?ut...

 

The single peperoni slice is the inner core, kalmata olives are the outer core, mushrooms, cheese and sauce are the mantle and the crust is, of course, the crust!

 

IMG_5219

Visitors thread coloured beads according to sequence sections from a range of organisms including trout, chimpanzee, butterfly, a flesh- eating microbe and rotting corpse flower. Depending on their age and understanding, visitors can also thread a second strand with complementary base pairs.

 

(via www.sanger.ac.uk and www.ebi.ac.uk)

 

www.yourgenome.org/downloads/sequence_bracelet_inst_A4.pdf

 

Chimpanzee (Pan troglodytes) GTATTTGTGGTAAACCCAGTG Sequence taken from the gene that codes for granulysin. Granulysin is a toxic protein that is released by immune cells in response to infection to kill pathogens like bacteria.

 

Brown trout (Salmo trutta) TACATCAGCACTAACTCAAGG Sequence taken from trout mitochondrial DNA. Variation in this sequence can be used to trace trout populations and evolution. Mitochondria are small energy factories within eukaryotic cells that have their own genome of about 16,000 base pairs.

 

Human (Homo sapiens) TCTGAGTTCTTACTTCGAAGG Sequence taken from part of the OCA2 gene. The OCA2 gene codes for a protein involved in pigmentation and variation in its sequence is a major influence on whether the colour of our eyes is brown or blue.

 

Butterfly (Danaus plexippus) ATGATCCCGACTATTACTATG Sequence from a gene that codes for an ‘opsin’ protein. This particular opsin protein reacts to ultraviolet (UV) light, which the butterfly uses to navigate.

 

Malayan spitting cobra (Naja sputatrix) AACCGACCGCTGCAACAACTG Sequence from a gene that codes for a toxin protein. This toxin is a component of the cobra’s venom, and blocks signals between the nerve and muscle cells of the cobra’s prey, paralysing them.

 

Flesh-eating microbe (Mycoplasma alligatoris) CAACAGTGATTTAGGTTACAC Sequence taken from part of the gene that codes for an enzyme called sialidase. When these bacteria infect an alligator they secrete sialidase to break-down the alligator’s tissues, enabling them to spread through its body.

 

Sweet orange (Citrus sinensis) TGCTACAGTTGCTGTTGTTGG Sequence taken from the gene that codes for pectinesterase. Pectinesterase is an enzyme that helps to break down the cell walls of the orange when it ripens, making the flesh soft.

 

Carnivorous plant (Drosera rotundifolia) GTAGCCACAGACTCAGTCATC Sequence taken from part of a gene that codes for a chitinase enzyme. The plant secretes these enzymes to break down the chitin-rich body casing of any insect that gets trapped on its tentacles.

 

Giant Madagascar hissing cockroach (Gromphadorhina portentosa) GATTCGCCGCTATCAGAAGAG Sequence taken from the gene that codes for histone 3. Histone 3 is one of eight histone proteins that combine to form nucleosomes, the bundles around which DNA is wrapped in the nucleus.

 

Corpse flower (Amorphophallus titanium) TCGAACCCGTTGTTGGGGAGG This sequence is from the gene that codes for the enzyme ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO). This enzyme is involved in plant photosynthesis and respiration.

 

www.yourgenome.org/teachers/bracelets.shtml

In 2002 Hans Bruno Lund introduced the concept

"Multicomplex Management (MCM)" as a platform

for a new series of management concepts and tools,

e.g. "Expected Creative Potential (ECP)", desig-

ned as personal tools for the CEO of large, multicom-

plex organizations in addition to the traditional mana-

gement concepts and tools.

 

As of January 2010 the new concepts / tools "Multicomplex Management (MCM)" and "Expected Creative Potential (ECP)" were referred to on more than 800.000 websites or 40.000.000 webpages.

 

Literature:

 

Lund, Hans Bruno

Multicomplex Management (MCM)

Version 3

CD-ROM, 741 colored illustrations

Hans Bruno Lund

Skodsborg

Denmark

2009

 

A multicomplex organization:

 

Organization Structure Model used: Nordic Industrial Fund - Nordic Council of Ministers - Bio & Chemistry Division (BCD) - Division REI-activities (Research / Education / Innovation): 5 programmes: NordFood, Nordic Wood, NordPap, NordBio and NordYeast; 748 projects; 6.000 participating private and public companies, institutions, organizations and agencies in 62 countries. BCD connected 180.000 researchers, operators, engineers, technicians and company, organization and agency executives (1998). BCD was - in combination with NordTek (the organization managing the cooperation of the 23 Nordic technical universities) - the largest industrial and technological REI-network in Northern Europe. BCD was a 27.000 ECP Organization connecting 278.000 people totalling 2.7 million ECP. Photo on Picture 1: Hans Bruno Lund visiting the governor of Oulu province, Finland Dr. Eino Siuruainen during a NordTek seminar.

 

Hans Bruno Lund

Contact: hansbrunolund@hotmail.com

 

Pictures to Multicomplex Management (MCM): 1, 2, 3, ... , 16.

 

Multicomplex Management (MCM) Pictures:

Picture 1 - 9 on Page 1

Picture 10 on Page 2

Picture 11 - 12 on Page 6

Picture 13 - 15 on Page 7

Picture 16 on Page 8

 

Multicomplex Management (MCM) is explained in Picture 2.

 

Expected Creative Potential (ECP) is explained in Picture 2.

 

RESEARCH SUBJECTS L - Z:

 

Comment:  are symboles for REI-areas which could

not be transferred from the original file.

 

L. brevis (Detmold)(080) 

L. plantarum (valencia) (080) 

Lac.Aci.Bac. (067-072/312/494) 

Lac.Pen. (073)

Landfill leachates (101/102)  XMX

Latex i betong(540) 

Lättklinker (683) 

LCA (152/634) XMX

LCA 17 (706) 

LCA in SWC (539) 

Leachates (101/102)  XMX

Leaching (095) XMX

Lean Logistics (113) 

Ledande polymerer (314/350) 

Leverens (180-183) 

Leverensepresisjon - Træ (625) 

Levnedsmidler (319) 

Light chain (NY16) 

Lignin (147/195)

Limning (532) 

Limträ (178) 

Limtræ (565/577/623) 

Limtræ (681) 

Lipases (031/033/505) 

Lipids (082-084/511) 

Livscykelanalyser (152)  XMX

Livsmedel - Bioteknik (390) 

Livsmedel (361)

Livsmedel och foder (405) 

Livsmedelskontakt (171-173) 

Loopfermentor (482) 

Low Fat Products (386) 

Lower carbohydrates (054) 

Lukkede produktionsanlæg (420)  XMX

Lut- och syraprocess (578)  XMX

Lysozyme (064)

Mammalian cell (041) 

Marin begroing (484)  XMX

Marine organisms (066) 

Marine råstoffer (297) 

Markedsudvikling - Træ (589) 

Marknader (184-187) 

Marksanering (465/590)  XMX

Marksanering (524/637)  XMX

Mass transfer (037) 

Massa (144/145/277/330/550)  XMX

Massa- och papper - Støy (213)  XMX

Massaframställning (216)  XMX

Mastevirke (556) XMX

Mastitisdiagnostik (396) 

MAT Gripen (126-132)

Material (126-132)

Material POM (525) 

Matfiskanlegg (395) 

Maturation processes (NY26) 

Meat (073-076/109) 

Medicin (270) 

Melkeproteiner (272) 

Membrane filtration (086) 

Membranes (NY03/18/19/25) 

Metal (415) 

Metaller (173)

Metallurgi (397/479) 

Metallutvinning (502) 

Metals (094-098)

Metan (234)  XMX

Methionine (NY06/14) 

Microbial Antagonists (108) 

Microtox (170)

Mikroalger (373)

Mikrobielt peroxidas (259) 

Mikrobiologi (172)

Mikroemulsioner (296) 

Mikroformering (308) 

Mikrosfärer (341) 

Mikroskopi (138) 

Miljö (239/582/585/600/615)  XMX

Miljö i garverier (194)  XMX

Miljöanpassad betong (516)  XMX

Miljödeklarationer (528)  XMX

Miljökrav skrotsmält (323)  XMX

Miljømodellering (449)  XMX

Miljø-ORS-Paraply (527)  XMX

Miljøovervågning (423)  XMX

Miljöprofilering djuptryck (515)  XMX

Miljørisiko - Gensplejsning (371)  XMX

Miljøteknologi (489)  XMX

Milk (106) 

Mine drainage (094)  XMX

Mineraler (535) 

Mitochondria (NY04/18) 

Mjukpapperstillverkning (211)  XMX

Möbelindustrin (232) 

Möbler (530/536/547/600) 

Modelling (040)

Modern blekteknik (143-152)  XMX

Molecular Imprinting (440) 

Molecular modelling (035) 

Molekylærbiologi (399) 

Mouse immunoglobulin (NY16) 

MRI-kontrastteknik (376) 

Multidetektor (385/411)  XMX

Muskelråvara (326) 

Mutant saturation (NY08/NY27) 

Mykfór (444)

N/C Ventil (269)

NanoScan (636) 

Närsaltreduktion (382)  XMX

Naturgas (191)  XMX

Navigationssystem (261) 

Near Critical Fluids (364) 

Network(542) 

NICOLE (603) 

Njurinflammation (347)

NMR-metodik (140) 

NoKos 01 (688) 

NoKos 01 (689) 

NoKos 02 (690) 

NoKos 03 (691) 

NoKos 04 (692) 

NoKos 05 (693) 

NoKos 06 (694)

NoKos 07 (695) 

NoKos 08 (696) 

NoKos 09 (697) 

NoKos 10 (698) 

NoKos 11 (699) 

NoKos 12 (700) 

NoKos 13 (701) 

NoKos 14 (702) 

NoKos 15 (703) 

NoKos 16 (704) 

NoKos 17 (705) 

NordBio (606) 

Norden/Baltikum (506) 

Nordfisk Blåvilling (217) 

Nordic Aluminium Cluster (542) 

Nordic Wood - Planlægning (504) 

Nordisk industriforsker (540/561) 

Nordisk industriforsker (581/583) 

Nordisk studentseminar (476) 

Nordkalott (523)

NordMark (587)

NordMiljö (196)  XMX

NordPap (133-176/499)  XMX

NordPhys (610) 

NordPhys (610)

NordTek (/576/579/584/633) 

NordTek (519/522/552/567/) XMX

NordTek 1990

NordTek 1991

NordTek 1992

NordTek 1993

NordTek 1994

NordTek 1995

NordTek 1996

NordTek 1997

NordTek 1998

NordTek 1999

NordTrap (535/586) 

North Calotte (611) 

Nuclear DCM (NY28) 

Nuclear envelope (NY20) 

Numerical Taxonomy (059) 

Nyfiber (133-142/493)  XMX

Odig. kolhydrater (393) 

Off-gas (481)  XMX

Offset (199/228/331/574/596)  XMX

Offset (4.2)  XMX

Olefiner (392)

Oligisakkarider (262) 

Oljeseparation (198) 

Oljeutvinning (252)  XMX

On Line Measuring Control (115) 

Öppningssäkerhet (343)  XMX

Optiska metoder (2.2.2) 

Order (180-183)

Organiske forbindelser (285) 

Organochlorines (091) 

Oxidkeramer (275) 

Oxygendelignifiering (195)  XMX

Ozonblekning (144/145/146/469)  XMX

Ozonblekning (3.1)  XMX

Ozonblekning (3.3.2.)  XMX

Pacific Rim (185)

Packaging (103-106)  XMX

PAH (092) 

Panax (258) 

Paper (231)  XMX

Papirmaskiner (208)  XMX

Papper (153-164) XMX

Papper (158/159) XMX

Papper (174-175) XMX

Papper (2.3)  XMX

Papper (432) XMX

Pappersbruk (225) XMX

Pappersindustrin (544)  XMX

Partikkelseparasjon (322) 

Patagonesis (427)

PCD (092)  XMX

Peptidsyntes (251) 

Perlit (203)

PET (104) 

Phospholipase C (036) 

Photosynthesis (473) 

Physiological effects (038) 

Physiological Engineering (508) 

Plant Cell Biotechnology (049-055)  XMX

Plasma Waste (381)  XMX

Plasmateknik (451) 

Plasmateknologi (455)  XMX

Podofyllotoxin (441)  XMX

Policy  (620)

Pollutants (090-093)  XMX

Polyelektrolyttitrering (133) 

Polymera material (379)  XMX

Polymerdager (321) 

Polymerer (307/314/320/350)  XMX

Polymerer (394/497)  XMX

Polymerisation (392)  XMX

Polysaccharides (509) 

Polysacharider (360/417/464) 

Por.sto.förd.(139)

Porstorlek (140) 

Potent. titrering (133) 

Preservation (067/072) 

Prickräkning (166) 

Probionsyrebakterier (601) 

Probiotic Foods (127) 

Process Environments (043)  XMX

Processfrämmande ämnen (149-151) 

Processing (618)  XMX

Produktionslogging (334) 

Produktionssystem (188-189)  XMX

Produktudvikling (582)  XMX

Profilin (NY13) 

Prosessregulering (492)  XMX

Proteases (058/429) 

Protein Eng. Konferens (299) 

Protein Eng. receptorer (367) 

Protein secretion (NY01/15/23) 

Protein software tools (031) 

Proteinstrukturer (477) 

Proteolytic mixtures (065) 

Provtrykning (162/163/164) 

Psychrophilic Org. (056-066) 

Psykrofile organismer (370) 

Pulp and Paper (085-089)  XMX

Pulping (256)  XMX

Pulvere (682) 

Punktkorrosion (223) 

Pyrophosphatase (NY18) 

Pyrophosphate (NY04/18) 

Quality Control (112-115)  XMX

Quality Definition (107-108)  XMX

Quality Measuring (109-111)  XMX

Quality of Emulsion Products (112)  XMX

Quality of Food (107-115)  XMX

RADIOBIO process (088) 

Råmaterial - Spånskivor (230) 

Rasterstruktur (154) 

Rayonfiber (244) XMX

Real Time Control (460) 

Rejeaffald (435)  XMX

Remediation (090) XMX

Rengøringskvalitet (408)  XMX

Replication control (NY11) 

Reproduktion - Fisk (594)  XMX

Returfiber (133-142/493)  XMX

Returfiberanalytik (5.1)  XMX

RNA polymerases (NY10) 

RNAs (NY10) 

Robotteknologi (374/628) 

Rotationspressar (222) 

Rye Technology (128) 

Saccharomyces cer. (001-030) 

Safe SS (541) 

Safety (126) 

Sågverk (226) 

Salmon (107)

Sanitation in Dairies (119)  XMX

Sausage (074/076)

Scallop viscera (064) 

Scand-Elpho '91 (467) 

SC-medier (445)

Screening (082) 

Seafloor (496)  XMX

Secretion in yeast (NY22) 

Sensoric Calibration (110) 

Sensors (043/110/240) 

Shelf life (077-081/105) 

Shellfish (123)  XMX

Simulation 01

Simulation 01

Simulation 02

Simulation 03

Simulation 04

Simulation 05

Självsmörjande skikt (271) 

Skogsindustri (210/235)  XMX

Skrotsmält (323) XMX

Skum (155)  XMX

Sludge (087/089/097/438)  XMX

Små och Mellanstore (316) 

Sockerraffinader (221) 

Soil (090/092/097) XMX

Sol / Gel (678) 

Solid Waste (099-102)  XMX

Soluble Starch Synthase (050) 

Sorbents (096) 

Sour Dough (068/131) 

Spånplader (530)

Spånskivor (230)

Spårbarhet (189) XMX

Spektroskopi (135)

Spektroskopi (2.2.1) 

Stålugn (204) XMX

Stålverk (190/343/518)  XMX

Standarder (165-176) 

Starch (049-055) 

Starch Enzymes (049/051) 

Starter cultures (073-076) 

Statik (710)

Steroler (457)  XMX

Stöblätt 01 (707) 

Stöblätt 02 (708) 

Stöblätt 03 (709) 

Størkning (255/293) 

Støveksplosjoner (201)  XMX

Støy (4.1.3.2)  XMX

Strategier (176) 

Strukturer (673) 

Strukturer (676) 

Strukturer (677) 

Studenterutbyte (551/553/566) 

Styrenbemängd luft (419)  XMX

Styrkesortering (181/534) 

Sulfat- och sulfitmassa (3.2)  XMX

Sulfatmassakokning (243)  XMX

Sulfitmassa (148) XMX

Supercritical Fluids (410) 

Superkritisk ekstraktion (340/351) 

Superkritiske medier (428) 

Surface 01

Surface 02

Surface 03

Surface 04

Surface 05

Surface 06

Surface 07

Surface 08

Surface 09

Surface properties (501) 

Surfaktanter (453)

Svartvatten (604)  XMX

Svejsning (711)

Syntese (061/333/380) 

Synteser i SC-medier (445) 

Syra-Base-egenskaper (134) 

TCF-blekning (148) 

TEMI (537) 

Termisk analyse (250) 

Termiske processer (279) 

Termofile enzymer (383) 

Termofile vektorer (430) 

Termokemisk databank (288) 

Termoplaster (332) 

Textilindustri (205)  XMX

Thermophile bakterier (300) 

Thermophile lipase activity (082) 

Thermophile organismer (370) 

Thermophiles (056/059) 

Thermophiles (487) 

Thermophilic microbiology (099) 

Thermophilic Organisms (056-066) 

Thorothermus Marinus (062) 

Threonine biosynthesis (NY06) 

Tidningspappers egenskaper (2.3) 

Toneradhesion (175) 

Torsk (483) 

Torv (254)  XMX

Total Quality Control (114) 

Toxilogi (172) XMX

TQMNW (598)

Trä (187/297/366/574)  XMX

Trä (297/599/624/625/626/627/628)  XMX

Trä (366)  XMX

Trä och Miljö (177)  XMX

Trä som ing.material (178-179)  XMX

Träbearbetning (233)  XMX

Træ (179/181/184/226/265/589)  XMX

Træ (306/559/562/580/597/622)  XMX

Træhus (622)  XMX

Träfönster (537) XMX

Trä-FoU-Miljøinfo (529)  XMX

Trähus i flera våningar (186)  XMX

Transcription (NY26) 

Transcription factors (NY10) 

Transcription of RNAs (NY10) 

Transcriptional control (NY21)

Transfer RNA (NY24) 

Transfertryck (388)  XMX

Tre (188) XMX

Trefiberplater och energiforbrug (214)  XMX

Trehus (533/627) XMX

Tribologi (684) 

Trimetoxibensaldehyd. (305) 

Troponin C (NY13) 

Tryck (248)  XMX

Tryckbarhet i offset (4.2)  XMX

Tryckfärg (160/245/283/363)  XMX

Tryckfärger (357) XMX

Tryckkvalitet (162)  XMX

Tryckkvalitet (4.1) XMX

Tryckmetoder (253/538)  XMX

Tryckning (495)  XMX

Trypsin (034) 

Tungmetaller (173)  XMX

Turbiditet (142) 

Tyrosin hydroksylase (313) 

Udbening af svinekød (368) 

Underglycosylated prot.A (NY30) 

Uppmätning av brus (155) 

Urinininkontinens (348) 

Utbeläggningar (549)  XMX

Utprovning/Utveckling (2.2) 

Value from Heads (124)  XMX

Vandstråleskæring (342) 

Våtlimning (532)

Vatten (167/604/608)  XMX

Vatten i järn- och stålverk (190)  XMX

Vattenburna tryckfärger (357)  XMX

Vax (485)  XMX

Vax i Well-returpapper (485)  XMX

Växtcellbioteknik (365/406)  XMX

Växtcellbioteknologi (406)  XMX

Vedråvara med fenol (257)  XMX

Vegetation Mapping (443)  XMX

Virke (545/556/572)  XMX

Virke och miljö (480)  XMX

Virkestorkning (418)  XMX

Virus (NY12)

Viskos rayonfiber (244)  XMX

VROS-system (267) 

Wastes (094/096) XMX

Wastewater (085/095/098/450)  XMX

Water in Fish Industry (122)  XMX

Water Jet Deboning (125)  XMX

Wheat bread (077-081) 

Wheat sourdough (079) 

Wiltshire bacon (075) 

Wood Cut (620) XMX

Wood XMX

Xylan (062) 

Xylanases (056/060/062) 

Xylose Utilixation (447) 

Yeast  XMX

Yeast ADE4 gene (NY11) 

Ytaktiv offsetfukt (228)  XMX

Ytbehandlat trä (287)  XMX

Ytbehandling betong (266)  XMX

Ytenergi (134)

Ytkemiska metoder (2.2.1) 

Ytsammensättning (134) 

Ytstruktur (2.2.2)

Ytterdörrar (183) XMX

Zink (675) 

Zinkholdig støv (518)  XMX

Zioliter (282) 

 

Literature

 

Lund, Hans Bruno

Multicomplex Management (MCM)

Version 3

CD-ROM, 741 colored illustrations

Dr. Hans Bruno Lund, Management Consultant

Skodsborg

Denmark

2009

 

Not available in libraries

  

Scientists at the National Institutes of Health have used RNA interference (RNAi) technology to identify dozens of genes which may represent new therapeutic targets for treating Parkinson’s disease. The findings also may be relevant to several diseases caused by damage to mitochondria, the biological power plants found in cells throughout the body. NIH scientists used RNAi to find genes that interact with parkin (green), a protein that tags damaged mitochondria (red). Mutations in parkin are linked to Parkinson’s disease and other mitochondrial disorders.

 

Credit: National Center for Advancing Translational Sciences (NCATS), National Institutes of Health

This image shows an osteosarcoma cell with DNA in blue, mitochondria in yellow and actin filaments, part of the cellular skeleton, in purple. One of the few cancers that originate in the bones, osteosarcoma is extremely rare, with less than a thousand new cases diagnosed each year in the United States. This image was featured in an exhibit called Life: Magnified from June 3, 2014, to January 21, 2015, at Washington Dulles International Airport's Gateway Gallery. Credit: D. Burnette and J. Lippincott-Schwartz, NICHD

mesa kiva3

Forget about work. Summer time is all about playing. Drink lots of liquid and party until your head falls off. or until red tree-like-things pop out from your eye socket..

 

-sold

Microscopic image of mitochondria within a single heart cell. Mitochondria highlighted in red were exposed to ultraviolet light.

 

More information: www.nih.gov/news-events/news-releases/researchers-discove...

 

Credit: National Heart, Lung and Blood Institute, National Institutes of Health