DNA Sequence Bracelets from the Wellcome Trust Sanger Institute / European Bioinformatics Institute
Visitors thread coloured beads according to sequence sections from a range of organisms including trout, chimpanzee, butterfly, a flesh- eating microbe and rotting corpse flower. Depending on their age and understanding, visitors can also thread a second strand with complementary base pairs.
(via www.sanger.ac.uk and www.ebi.ac.uk)
www.yourgenome.org/downloads/sequence_bracelet_inst_A4.pdf
Chimpanzee (Pan troglodytes) GTATTTGTGGTAAACCCAGTG Sequence taken from the gene that codes for granulysin. Granulysin is a toxic protein that is released by immune cells in response to infection to kill pathogens like bacteria.
Brown trout (Salmo trutta) TACATCAGCACTAACTCAAGG Sequence taken from trout mitochondrial DNA. Variation in this sequence can be used to trace trout populations and evolution. Mitochondria are small energy factories within eukaryotic cells that have their own genome of about 16,000 base pairs.
Human (Homo sapiens) TCTGAGTTCTTACTTCGAAGG Sequence taken from part of the OCA2 gene. The OCA2 gene codes for a protein involved in pigmentation and variation in its sequence is a major influence on whether the colour of our eyes is brown or blue.
Butterfly (Danaus plexippus) ATGATCCCGACTATTACTATG Sequence from a gene that codes for an ‘opsin’ protein. This particular opsin protein reacts to ultraviolet (UV) light, which the butterfly uses to navigate.
Malayan spitting cobra (Naja sputatrix) AACCGACCGCTGCAACAACTG Sequence from a gene that codes for a toxin protein. This toxin is a component of the cobra’s venom, and blocks signals between the nerve and muscle cells of the cobra’s prey, paralysing them.
Flesh-eating microbe (Mycoplasma alligatoris) CAACAGTGATTTAGGTTACAC Sequence taken from part of the gene that codes for an enzyme called sialidase. When these bacteria infect an alligator they secrete sialidase to break-down the alligator’s tissues, enabling them to spread through its body.
Sweet orange (Citrus sinensis) TGCTACAGTTGCTGTTGTTGG Sequence taken from the gene that codes for pectinesterase. Pectinesterase is an enzyme that helps to break down the cell walls of the orange when it ripens, making the flesh soft.
Carnivorous plant (Drosera rotundifolia) GTAGCCACAGACTCAGTCATC Sequence taken from part of a gene that codes for a chitinase enzyme. The plant secretes these enzymes to break down the chitin-rich body casing of any insect that gets trapped on its tentacles.
Giant Madagascar hissing cockroach (Gromphadorhina portentosa) GATTCGCCGCTATCAGAAGAG Sequence taken from the gene that codes for histone 3. Histone 3 is one of eight histone proteins that combine to form nucleosomes, the bundles around which DNA is wrapped in the nucleus.
Corpse flower (Amorphophallus titanium) TCGAACCCGTTGTTGGGGAGG This sequence is from the gene that codes for the enzyme ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO). This enzyme is involved in plant photosynthesis and respiration.
DNA Sequence Bracelets from the Wellcome Trust Sanger Institute / European Bioinformatics Institute
Visitors thread coloured beads according to sequence sections from a range of organisms including trout, chimpanzee, butterfly, a flesh- eating microbe and rotting corpse flower. Depending on their age and understanding, visitors can also thread a second strand with complementary base pairs.
(via www.sanger.ac.uk and www.ebi.ac.uk)
www.yourgenome.org/downloads/sequence_bracelet_inst_A4.pdf
Chimpanzee (Pan troglodytes) GTATTTGTGGTAAACCCAGTG Sequence taken from the gene that codes for granulysin. Granulysin is a toxic protein that is released by immune cells in response to infection to kill pathogens like bacteria.
Brown trout (Salmo trutta) TACATCAGCACTAACTCAAGG Sequence taken from trout mitochondrial DNA. Variation in this sequence can be used to trace trout populations and evolution. Mitochondria are small energy factories within eukaryotic cells that have their own genome of about 16,000 base pairs.
Human (Homo sapiens) TCTGAGTTCTTACTTCGAAGG Sequence taken from part of the OCA2 gene. The OCA2 gene codes for a protein involved in pigmentation and variation in its sequence is a major influence on whether the colour of our eyes is brown or blue.
Butterfly (Danaus plexippus) ATGATCCCGACTATTACTATG Sequence from a gene that codes for an ‘opsin’ protein. This particular opsin protein reacts to ultraviolet (UV) light, which the butterfly uses to navigate.
Malayan spitting cobra (Naja sputatrix) AACCGACCGCTGCAACAACTG Sequence from a gene that codes for a toxin protein. This toxin is a component of the cobra’s venom, and blocks signals between the nerve and muscle cells of the cobra’s prey, paralysing them.
Flesh-eating microbe (Mycoplasma alligatoris) CAACAGTGATTTAGGTTACAC Sequence taken from part of the gene that codes for an enzyme called sialidase. When these bacteria infect an alligator they secrete sialidase to break-down the alligator’s tissues, enabling them to spread through its body.
Sweet orange (Citrus sinensis) TGCTACAGTTGCTGTTGTTGG Sequence taken from the gene that codes for pectinesterase. Pectinesterase is an enzyme that helps to break down the cell walls of the orange when it ripens, making the flesh soft.
Carnivorous plant (Drosera rotundifolia) GTAGCCACAGACTCAGTCATC Sequence taken from part of a gene that codes for a chitinase enzyme. The plant secretes these enzymes to break down the chitin-rich body casing of any insect that gets trapped on its tentacles.
Giant Madagascar hissing cockroach (Gromphadorhina portentosa) GATTCGCCGCTATCAGAAGAG Sequence taken from the gene that codes for histone 3. Histone 3 is one of eight histone proteins that combine to form nucleosomes, the bundles around which DNA is wrapped in the nucleus.
Corpse flower (Amorphophallus titanium) TCGAACCCGTTGTTGGGGAGG This sequence is from the gene that codes for the enzyme ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO). This enzyme is involved in plant photosynthesis and respiration.