Microbotryum stellariae on Water Chickweed (Myosoton aquaticum) 10.10.17 (10)

Professor Michael Hood from Amherst College, Amherst, MA USA, has kindly DNA tested for me, specimens of anther smut (Microbotryum stellariae ) from samples of Water Chickweed (Myosoton aquaticum) that I sent to him after I found it at RSPB Minsmere on 10.10.2017 (seen also back on 15.10.2016 but not tested).

Thanks to Michael, he noticed the anther smut on photos in my Wild Flowers - White album, on Flickr. These photos were taken on 15.10.2016 and I visited the year after (last year) on 10.10.2017 and found the anther smut still there in 3 different areas where the Water Chickweed (Myosoton aquaticum) was growing.

For the technicians among you here are some of Michael’s comments and also the DNA sequence ;

‘’We were able to get the DNA sequence data on the specimen you collected. The particular DNA region is involved in the machinery for making proteins (the ribosomal RNA), and it is the most common region used to discriminate species. And then there is a database search that allow comparison of DNA sequences to known species, called BLAST. The fungus you collected is the most similar to Microbotryum stellariae in the database, nearly identical. This species is indexed here: www.speciesfungorum.org/Names/SynSpecies.asp?RecordID=110227

The first reference, under a different species name at the time, was by Sowerby in 1803 in a series called "Coloured Figures of English Fungi," image pasted below.

The DNA sequence is shown below as well ;

Microbotryum from Myosoton aquaticum (ribosomal RNA spacer regions)

TCGGGGGGTCTATAAGCTTTCCACTTTTCCCAGGCCAGCCATTACACCCCGGTAAAGGGATGCCATGTCCTCAGCGAATAGTCTATTACACCGAGTCAATCTGATCTCGAAGATTAGGATGCTAATGCATTACGAACGAGCTTCGACTCTAGAATCCCCCAAAAGGAATCCCAGTCCAGCAAACGTTCAGAAACCAAGCCGCGCCCCAATCTCCATAAGAAAAAGGGGGGGTTGAAGAGTTCACGACACTCAAACAGACTGCTCGCCGGAATACCAGCGAGCGCAGATGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCCATTACTTATCCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTTTTTTTGTTATATAATTTCTTTTTTCCCATACCATTGACTTTAAATGTTTAATAAAACGAGCGGGCACAAATTCCTGGCAAAGCTAATCGCCTTTCCTTGGCCCCCCCATTAGAAGTGCACAGAGTTTGAAAAAGTGAGAGGNCACGCCCTGGTTAAACAGGTACGCTATAAATTCACTAATGATCCTTCCGCAGGTTACCTACGGAAGGACAATAGNGAAGTATAGCGTAC

 

Mark Joy 8.4.2018

Done